Sign up & Download
Sign in

Construction of recombinant adeno-associated virus vector co-expressing hVEGF165 and hBMP-7 genes

by Xianghui Huang, Zhibin Shi, Kunzheng Wang, Xiaoqian Dang, Pei Yang, Pengbo Yu
Zhongguo xiu fu chong jian wai ke za zhi Zhongguo xiufu chongjian waike zazhi Chinese journal of reparative and reconstructive surgery ()

Abstract

OBJECTIVE: To construct the recombinant adeno-associated virus (rAAV) vector co-expressing hVEGF165 and hBMP-7 depending on internal ribosome entry site (IRES) sequence, to measure the virus titer and to verify the correct recombination. METHODS: The AAV helper-free system was used to generate the rAAV co-expressing hVEGF165 and hBMP-7 genes. The IRES sequence from the bicistronic eukaryotic expression plasmid pIRES was cut down and subcloned into the ITR/MCS containing vector pAAV-MCS to get pAAV-MCS A-IRES-MCS B, in which upstream MCS A and downstream MCS B was constructed. The hVEGF165 and hBMP-7 genes were amplified by PCR and inserted into MCS A and MCS B respectively. The recombinant expression plasmid pAAV-hVEGF165-IRES-hBMP-7 was co-transfected into AAV-293 cells with pHelper and pAAV-RC for packaging of recombinant AAV. The green fluorescent protein (GFP) labeled rAAV-IRES-GFP was simultaneously packaged by using the parallel plasmid pAAV-IRES-GFP. The efficiency of rAAV packaging was monitored under fluorescent microscope and recombinant viral particles were harvested from infected AAV-293 cells. The virus titer was measured through infecting AAV-HT1080 cells, and the recombinant rAAV-hVEGF165-IRES-hBMP-7 was verified by PCR of the exogenous interest genes of hVEGF165 and hBMP-7. RESULTS: The recombinant plasmid pAAV-hVEGF165-IRES-hBMP-7 was verified by double digestion. Using the AAV helper-free system, GFP expression could be observed under fluorescent microscope 72 hours after triple plasmid co-transfection and the system provided a high packing ratio of 95%-100%. The rAAV has a high purity and high titer of 5.5 x 10(11) vp/mL, and AAV-HT1080 cell could be infected at a ratio of 90%. The recombinant virus was confirmed by PCR of exogenous hBMP-7 and hVEGF165 genes. CONCLUSION: Recombinant rAAV-hVEGF165-IRES-hBMP-7 was successfully constructed with a high virus titer, which may offer the basement of in vitro and in vivo experiments of hVEGF165 and hBMP-7 co-expressing for gene therapy of bone regeneration.

Cite this document (BETA)

Available from www.ncbi.nlm.nih.gov
Page 1
hidden

Construction of recombinant adeno...

205 Journal of Nanjing Medical University 2008 22(4):205-210 Research Paper www.elsevier.com/locate/jnmu JNMU Construction of recombinant adeno-associated virus vector co-expressing hVEGF165 and hBMP7 gene Zhibin Shia,*, Xianghui Huanga, Kunzheng Wanga, Xiaoqian Danga, Pei Yanga, Pengbo Yub aDepartment of Orthopedics, the Second Affiliated Hospital of Xi an Jiaotong University, Xi an 710004, Shaanxi Province China bLaboratory of Virus, Shaanxi Provincial Center for Disease Control and Prevention, Xi an 710054, Shaanxi Province, China Received 5 January, 2008 Abstract Objective: To construct recombinant adeno-associated virus co-expressing human vascular epithelial growth factor 165(hVEGF165) and bone morphogenetic protein 7(hBMP7), measure the virus titer and verify the recombination. Methods:The AAV helper-free system was used as basis to generate recombinant AAV. The IRES sequence of plasmid pIRES was cut down and subcloned into ITR/ MCS containing vector pAAV-MCS to construct recombinant plasmid pAAV-MCSa-IRES-MCSb. The hVEGF165 and hBMP7 gene was amplified by PCR and inserted into upstream MCSa and downstream MCSb respectively. Then, recombinant plasmid pAAV- hVEGF165-IRES-hBMP7, pAAV-RC and pHelper were co-transfected into AAV-293 cells to complete rAAV-hVEGF165-IRES-hBMP7 packaging. The GFP labeled rAAV-IRES-GFP was simultaneously packaged by using the parallel plasmid pAAV-IRES-hrGFP. The efficiency of AAV packaging was monitored under fluorescent microscope and recombinant viral particles were harvested from infected AAV-293 cells. The virus titer was measured by infecting AAV-HT1080 cells, and the recombinant AAV-hVEGF165-IRES-hBMP7 was verified by PCR of the exogenous interest genes. Results:Recombinant pAAV-hVEGF165-IRES-hBMP7 was verified by double digestion. GFP expression in AAV-293 could be observed under fluorescent microscope 72 h after transfection and the system provided a high packing ratio of 95%. The recombinant adeno-associated virus has a high titer of 5.5 1011vp/ml, and AAV-HT 1080 was infected at a ratio of 90%. The recombinant virus was confirmed by PCR of exogenous hBMP7 and hVEGF165 gene. Conclusion:Recombinant rAAV-hVEGF165-IRES-hBMP7 was successfully constructed with a high virus titer, which may offer foundation for in vitro and in vivo experiments of hVEGF165 and hBMP7 co-expression and provide a new method for gene therapy of bone regeneration. Key words: adeno-associated virus human vascular endothelial factor human bone morphogenetic protein internal ribosome entry site This work was supported by National Natural Science Foundation of China(No.30600624) *Corresponding auther. E-mail address: jackky9999@163.com INTRODUCTION Recent research shows that bone formation and reno- vation is a coordinated process involving various bio- logicalfactors and their effects may beenhanced by each other. Among these factors VEGFs and BMPs play important roles and are surveyed extensively. Orches- trating the presentation of these two factors may greatly enhance the process ofbone formation and regeneration. We have developed the recombinant AAV vector system capable of sustained co-expression of hVEGF165 and hBMP7, which may offer foundation for in vitro and in vivo experiments of hVEGF165 and hBMP7 co-expres- sion and provide a new method for gene therapy of bone regeneration. MATERIALS AND METHODS Materials AAV Helper Free System(pAAV-MCS vector, pAAV-IRES-GFP vector, pAAV-RC plasmid, and pHelper plasmid) and AAV-293 packaging cell line, AAV HT-1080 cells were purchased from Stratagene, USA. E.coli DH5 was a stocked strain from Shaanxi CDC. Plasmid pUC18-hHVEGF165 and pBluescript KS- hBMP7 were constructed previously by Dr. Zhibin Shi
Page 2
hidden
206 Z.Shi et al. / Journal of Nanjing Medical University, 2008, 22(4): 205-210 and plasmid pIRESwas kindly provided by Dr. Zhiming Hao(Department of Digestology, 1st Affiliated Hospital of School of Medicine, Xi an Jiaotong University). Restriction enzyme and DNA marker were purchased from TAKARA, China. The primers were synthesized by Augtc, China. Plasmid Mini preps and Agarose Gel DNA Extraction Kit were purchased from Qiagen, Germany. DMEM-H Growth Medium and fetal bovine serum were purchased from GIBIC, USA. Calcium Phosphate Cell Transfection Kit was purchased from Invitrogen, USA. Methods Construction of the recombinant expression plasmid pAAV-hVEGF165-IRES-hBMP7 In order to construct AAV vector co-expressing two different genes, we firstly inserted a fragment of IRES sequence into the multiple clone sites of pAAV-MCS to get IRES linked bicistronic expression cassette. The plasmid pIRES was digested with EcoR I and BamH I, which respectively located on the upside and downside of IRES sequence. Then the IRES fragment was iden- tified and extracted by 1% agarose gel electrophoresis. The purified IRES fragment was subcloned directly into the multiple cloning sites of pAAV-MCS which was also digested with EcoR I and BamH I. The positive recombinant clone was named pAAV-MCSa-IRES- MCSb. Secondly, hVEGF165 gene was inserted into the upstream MCSa of pAAV-MCSa-IRES-MCSb. Primers were designed according to the sequence published at PubMed(NM_OD3376) to amplify hVEGF165 cDNA. Primer F-vegf:5 -CCATCGATATGAACTTTCTGCT GTCTTG-3 , in which cleavage site of Cla I was added, primer R-vegf: 5 -CGGAATTCTCACCGCCTCGGC TTGTC-3 , in which cleavage site of EcoR I was added. The pUC18-hVEGF165 was used as template to conduct PCR. The PCR products were separated and purified by 1.0% agarose gel electrophoresis. Both the PCR products and plasmid pAAV-MCSa-IRES-MCSb were digested with Cla I and EcoR I, then the PCR segments with adhesive ends were ligased into the upstream mul- tiple cloning sites a(MCSa) of pAAV-MCSa-IRES- MCSb. After verifying with cleavage and PCR scree- ning, the positive clone was named pAAV-hVEGF165- IRES-MCSb. Finally, hBMP7 gene was inserted into the downstream MCSb of pAAV-hVEGF165-IRES-MCSb. Primers were designed according to the sequence pub- lished at PubMed(NM_001719). F-BMP was 5 - GGCCGGATCCATGCACGTGCGCTCACT GCG-3 , in which cleavage site of BamH I was added R-BMP was 5 -GGCCGTCGACCTAGTGGCAGCC ACAG- 3 , in which cleavage site of Sal I was added. The pBluescript KS-hBMP7 was used as template to conduct PCR. Both the purified PCR products and plasmid pAAV-hVEGF165-IRES-MCSb were digested with BamH I and Sal I, and with T4 DNA ligase the hBMP7 segments were ligased into the downstream multiple cloning sites(MCSb) of pAAV-hVEGF165-IRES-MCSb. The positive clone was named pAAV-hVEGF165-IRES- hBMP7. The whole procedure of recombination was detailed in Fig. 1. We further identified the positive clone by different combination of double digestion using Cla I, BamH I and Sal I for verifying of the reconstruction. Packagingof recombinant adeno-associated virus co-expressing hVEGF165 and hBMP7 gene AAV-293 cells were cultured in high glucose DMEM supplemented with 10% fetal bovine serum at 37 and 5% CO2. The cells were placed on 100 mm tissue culture plate 48 hours prior to transfection. With calcium phos- phate transfection protocol, the triple transfection of pAAV-hVEGF165-IRES-hBMP7, pAAV-RC and pHelper was performed to package the recombinant AAV-hVEGF165-IRES-hBMP7(experimentalgroup) the triple transfection of plasmid pAAV-IRES-hrGFP, pAAV-RC and pHelper was used to construct rAAV- IRES-GFP which was labeled with GFP and served as viral production parallel group and a negative control group was performed for simultaneous observation by substituting the recombinant AAV expression plasmid with 10 l TE buffer. The progress of AAV particle production was monitored under inverted microscope by observing phenotypic changes and cell-cytotoxic reaction of the AAV-293 cells, and the expression of green fluorescent protein in AAV-293 was detected under fluorescence microscope at 24 h, 48 h and 72 h after transfection. The ratio of cells labeled with GFP was calculated to ascertain the packaging efficiency. Fig. 1 Conceptualdiagram of construction of pAAV-hVEGF165- IRES-hBMP7

Readership Statistics

2 Readers on Mendeley
by Discipline
 
 
by Academic Status
 
50% Student (Master)
 
50% Researcher (at a non-Academic Institution)
by Country
 
50% Canada
 
50% United States

Sign up today - FREE

Mendeley saves you time finding and organizing research. Learn more

  • All your research in one place
  • Add and import papers easily
  • Access it anywhere, anytime

Start using Mendeley in seconds!

Already have an account? Sign in