Evolution of Primate ABO Blood Group Genes and Their Homologous Genes1 Naruya Saitou* and Fumi-ichiro YamamotoJf *Laboratory of Evolutionary Genetics, National Institute of Genetics, Mishima, Japan and TThe Burnham Institute, La Jolla, California There are three common alleles (A, B, and 0) at the human ABO blood group locus. We compared nucleotide sequences of these alleles, and relatively large numbers of nucleotide differences were found among them. These differences correspond to the divergence time of at least a few million years, which is unusually large for a human allelic divergence under neutral evolution. We constructed phylogenetic networks of human and nonhuman primate ABO alleles, and at least three independent appearances of B alleles from the ancestral A form were observed. These results suggest that some kind of balancing selection may have been operating at the ABO locus. We also constructed phylogenetic trees of ABO and their evolutionarily related cw-1,3-galactosyltransferase genes, and the divergence time between these two gene families was estimated to be roughly 400 MYA. Introduction The human ABO blood group was discovered by Karl Landsteiner in 1900, and its mode of inheritance as multiple alleles at a single genetic locus was estab- lished by Felix Bernstein a quarter century later (Crow 1993). Immunodominant ABH antigens were chemically characterized to be carbohydrate structures of glycopro- teins and glycolipids through the studies performed in the 1950s and early 1960s (see Yamamoto 1995 for re- view). Based on this finding, ABO alleles A and B were hypothesized to code for glycosyltransferases which transfer GalNAc and galactose, respectively, while 0 was hypothesized to be a null allele incapable of coding for a functional glycosyltransferase. Yamamoto et al. (1990a, 1990b) determined the cDNA sequences of three common alleles, Al, B, and 0, and Yamamoto, McNeill, and Hakomori (1995) determined the genomic organization of the gene. The purpose of this paper is to analyze the nucle- otide and amino acid sequences for primate ABO blood group genes and their homologous genes. Biological sig- nificance of the ABO blood group will be discussed based on the clues obtained from phylogenetic analyses of ABO blood group genes. Materials and Methods For human ABO blood group genes (hereafter called ���ABO genes���), sequence data of Yamamoto et al. (1990a, 1990b, 1992, 1993a, 1993b, 1993c, 19934 and those of Ogasawara et al. (1996~) were used. Table 1 lists the variant nucleotide sites for the human alleles. It should be noted that allele 02, named by Grunnet et al. (1994), has the identical sequence with O-3, previ- ously reported by Yamamoto et al. (1993b). The coor- dinate system of the nucleotide and amino acid positions l Dedicated to the memory of the late Dr. Motoo Kimura. Key words: ABO blood group, glycosyltransferase, primates, polymorphism, overdominant selection, phylogenetic network. Address for correspondence and reprints: Naruya Saitou, Labo- ratory of Evolutionary Genetics, National Institute of Genetics, 1111 Yata, Mishima-shi, Shizuoka-ken, 411, Japan. E-mail: nsaitou@ genes.nig.ac.jp. Mol. Biol. Evol. 14(4):399411. 1997 0 1997 by the Society for Molecular Biology and Evolution. ISSN: 0737-4038 of the human and nonhuman primate ABO gene se- quences follows that of Yamamoto (1995). As for nonhuman primate ABO gene sequences, those for two chimpanzees (Pan troglodytes), one gorilla (Gorilla gorilla), two orangutans (Pongo pygmaeus), one crab-eating macaque (Macaca fascicularis), and two yellow baboons (Papio cynocephalus) are from Komi- nato et al. (1992), and sequences for three chimpanzees, three gorillas, and two orangutans are from Martinko et al. (1993). Table 2 lists the variant nucleotide sites for the primate sequences. Amino acid sequence differences between positions 152-355 among those human and nonhuman primate sequences are shown in table 3. As for the primate ABO-related seqtrences, the hgt4 pseudogene found from the human genome (Yamamoto, McNeill, and Hakomori 1991) and the mouse ABO gene (unpublished data) were used, as well as the cx-1,3-gal- actosyltransferase functional gene cDNA sequences of mice (Larsen et al. 1989), cow (Joziasse et al. 1989), and pig (Strahan et al. 1995). The two human pseudo- genes for the (Y- 1,3-galactosyltransferase gene were also included an ordinary type (Larsen et al. 1990) and a processed type (Joziasse et al. 1991). Galili and Swanson (1991) determined partial nu- cleotide sequences of the CX- 1,3-galactosyltransferase functional gene for squirrel monkey (Saimiri sciureus), spider monkey (Ateles geofiroyi), and howler monkey (Alouatta caraya), and its pseudogenes for chimpanzee, gorilla, orangutan, rhesus monkey (Macaca mulatta), green monkey (Cercopithecus aethiops), and patas mon- key (Erythrocebus patas). Henion et al. (1994) also se- quenced the complete coding region of this gene for marmoset (Callithrix sp.). Those sequences were used to construct a primate-specific tree for this gene. We searched the latest version of the DDBJ/EMBL/ GenBank international nucleotide sequence database by using BLAST (Altschul et al. 1990) and FASTA (Pear- son and Lipman 1988), and did not find any sequence homologous to the ABO blood group gene. Phylogenetic trees were constructed by using the neighbor-joining method (Saitou and Nei 1987) and the maximum-likelihood method (Felsenstein 198 1) for rel- atively distantly related sequences. When the neighbor- joining method was applied, Kimura���s (1980) two-pa- 399 by guest on December 6, 2011 http://mbe.oxfordjournals.org/ Downloaded from

400 Saitou and Yamamoto Table 1 Sequence Comparison of the Human ABO Blood Group Locus Alleles NUCLEOTIDE POSITION 11 ALLELE 1112224555666777788889E 099069626745802790027355 912317764967131162391049 abcbccbaccaccaacaabaaccb REFERENCE A���-l(A1O1) ...... A���-2(A102) ...... A���-3(A103) ...... A���-4(A104) ...... A2 .............. AX. ............. A���-1 ............ cis-AB .......... o-1 (0101). ...... o-2 (0201). ...... o-3 ............. O-4 (0102). ...... o-5 (0103). ...... O-6 (0202). ...... O-7 (0203) ...... B-l (BlOl). ...... B-2 (B102). ...... B-3 (B103). ...... BcA) ............. B���-1 ............ GGCCGACCCTTCGGCCCGGGGGCC ...... T ................. **** ..T.T ............... ****.G .................. ***A T .. ................ . **** ...... A ............. **xx ................ A ... **XX T .. ........... C ..... .. ..- ................... TATT-G. . ..A.A..T...A .... ****.G.G.........A ...... ****-....c .............. ****-G .................. ****-.....A .A T...A .. .... ***k-G .. ..A.A.TT...A .... ..... G.G .. .T.A..A.C..A .. ****.G.G...T.A..A.C ..... ****.G.G.....A..A.C..A .. ****.G.G........A.C..A .. ****.G.G .. .T.A..A.C..AT. Yamamoto et al. (1990~) Yamamoto et al. (1990~) Ogasawara et al. (1996~) Ogasawara et al. (1996~) Yamamoto, McNeill, and Hakomori (1992) Yamamoto et al. (1993~) Yamamoto et al. (19934 Yamamoto et al. (1993~) Yamamoto et al. (1990~) Yamamoto et al. (1990~) Yamamoto et al. (1993b) Ogasawara et al. (1996~) Ogasawara et al. (1996~) Ogasawara et al. (1996~) Ogasawara et al. (1996~) Yamamoto et al. (1990u) Ogasawara et al. (1996~) Ogasawara et al. (1996~) Yamamoto et al. (1993~) Yamamoto et al. (19934 NOTE.-Dots, asterisks, and hyphens mean identical nucleotides as the human Al-1 sequence, nonexamined positions, and gaps, respectively. Position 1059 can be either 1059, 1060, or 1061. Allele names in parentheses were used in Ogasawara et al. (1996~2). Letters (a, b, or c) below nucleotide position numbers mean first, second, or third nucleotide positions, respectively. Table 2 Sequence Comparison of the Primate ABO Blood Group Locus Genes (Positions 435- 1003) NUCLEOTIDE POSITION 11 4444444444455555555556666677777777888889900 3556667788801122378892245800116789012247900 8077891407963917495931921124195736335670902 REFER- ALLELE ccabcacccbcbccbbcccabcbccccbcacccabccabbcac ENCE Al-1 (human). ................ TTACGGCGCAGAAGAGCTCGGGTGCGCGCGCCCCGGAGGTCGC 1 Chimpanzee-l.. .............. .... A. .A.. .. G.. .... C.. .... T.. .. T . ..A.. ... T. 2 Chimpanzee-2.. .............. .... A ..A.. .. G.. .... C.. .... T.. ...... . ..... T. 2 Chimpanzee-3(Patr-1) ......... **. ........ .G ..... .C .......... .T .. .A .. .**** 3 Chimpanzee-4(Patr-2). ........ **.T ....... .G ..... .C ..... .T ...... ..A .. .**** 3 Chimpanzee-5(Patr-3). ........ **. .. . .... C.G.. .... C.. .... T.. ...... A...*** * 3 Gorilla-l. ............................... .G. .................. .AC. .... .A. 2 Gorilla-2,4,5 (Gogo-1,3,4) ...... **. ........ .G. **** .................. .AC. ... 3 Gorilla-3(Gogo-2) ............ **. ........ .G ................... .AC. .A.**** 3 Gorilla-6(Gogo-5) ............ **. ........ .G ......... .T ........ .AC ... .**** 3 Orangutan-l.. ................ .......... ..G .G.. .... A ..T.. .. CT.. .. A ..A.. .. 2 Orangutan-2.. ................ ........... .G.G.. .. ..A. .T.. . .CT .. ..A.. ..... 2 Orangutan-3(Popy-1). ......... **T ....... .TT.GT. .G. .A. .T ... .C ........ .**** 3 Macaque.. ................... GC.. .. T.GG..GTG.TC..A...TA.CT...TT..G..CT .G 2 Baboon-l.. .................. CC.. .. T.GG..GTG.TC.. ..C..A .C.. .. TT.AG..CT .G 2 Baboon-2.. .................. CC.. .. T.GG..GTG.T C.. .. C..A.CT...TAC.G..CT .G 2 NOTE.--Dots and asterisks mean identical nucleotides as the human Al-1 sequence and nonexamined positions, re- spectively. Allele names in parentheses were used in Martinko et al. (1993). Letters (a, b, or c) below nucleotide position numbers mean first, second, or third nucleotide positions, respectively. References are as follows: 1, Yamamoto et al. (1990~) 2, Kominato et al. (1992) 3, Martinko et al. (1993). by guest on December 6, 2011 http://mbe.oxfordjournals.org/ Downloaded from