ral
ssBioMed Cent
BMC Medical Genetics
Open Acce
Research article
Case-control and family-based association studies of candidate
genes in autistic disorder and its endophenotypes: TPH2 and GLO1
Roberto Sacco
1,2
, Veruska Papaleo
1,2
, Jorg Hager
3
, Francis Rousseau
3
,
Rainald Moessner
4
, Roberto Militerni
5
, Carmela Bravaccio
6
, Simona Trillo
7
,
Cindy Schneider
8
, Raun Melmed
9
, Maurizio Elia
10
, Paolo Curatolo
11
,
Barbara Manzi
11
, Tiziana Pascucci
12,13
, Stefano Puglisi-Allegra
12,13
, Karl-
Ludvig Reichelt
14
and Antonio M Persico*
1,2
Address:
1
Laboratory of Molecular Psychiatry and Neurogenetics, University "Campus Bio-Medico", Via Longoni 83, I-00155 Rome, Italy,
2
Laboratory of Molecular Psychiatry and Psychiatric Genetics, Department of Experimental Neurosciences, I.R.C.C.S. "Fondazione Santa Lucia",
Rome, Italy,
3
IntegraGen SA. Genopole, Evry, France,
4
The Center for Applied Genomics, University of Toronto, Canada,
5
Department of Child
Neuropsychiatry, II University of Naples, Italy,
6
Department of Child Neuropsychiatry, University "Federico II", Naples, Italy,
7
ASL RM/B, Rome,
Italy,
8
Center for Autism Research and Education, Phoenix, AZ, USA,
9
Southwest Autism Research and Resource Center, Phoenix, AZ, USA,
10
Unit
of Neurology and Clinical Neurophysiopathology, I.R.C.C.S. "Oasi Maria S.S.", Troina, EN, Italy,
11
Department of Child Neuropsychiatry,
University "Tor Vergata", Rome, Italy,
12
Department of Psychology, University "La Sapienza", Rome, Italy,
13
Laboratory of Behavioral
Neurobiology, Department of Experimental Neurosciences, I.R.C.C.S. "Fondazione Santa Lucia", Rome, Italy and
14
Department of Pediatric
Research, Rikshospitalet, University of Oslo, Norway
Email: Roberto Sacco - r.sacco@unicampus.it; Veruska Papaleo - veruskapapaleo@virgilio.it; Jorg Hager - jorg.hager@integragen.com;
Francis Rousseau - francis.rousseau@integragen.com; Rainald Moessner - rainald_moessner@yahoo.com;
Roberto Militerni - roberto.militerni@unina2.it; Carmela Bravaccio - carmela.bravaccio@unina2.it; Simona Trillo - simona.trillo@tiscalinet.it;
Cindy Schneider - cschneider@center4autism.org; Raun Melmed - raun.melmed@melmedcenter.com; Maurizio Elia - melia@oasi.en.it;
Paolo Curatolo - curatolo@uniroma2.it; Barbara Manzi - bmanzi@libero.it; Tiziana Pascucci - tiziana.pascucci@uniroma1.it; Stefano Puglisi-
Allegra - stefano.puglisi-allegra@uniroma1.it; Karl-Ludvig Reichelt - karlr@ulrik.uio.no; Antonio M Persico* - a.persico@unicampus.it
* Corresponding author
Abstract
Background: The TPH2 gene encodes the enzyme responsible for serotonin (5-HT) synthesis in the Central Nervous
System (CNS). Stereotypic and repetitive behaviors are influenced by 5-HT, and initial studies report an association of
TPH2 alleles with childhood-onset obsessive-compulsive disorder (OCD) and with autism. GLO1 encodes glyoxalase I,
the enzyme which detoxifies α-oxoaldehydes such as methylglyoxal in all living cells. The A111E GLO1 protein variant,
encoded by SNP C419A, was identifed in autopsied autistic brains and proposed to act as an autism susceptibility factor.
Hyperserotoninemia, macrocephaly, and peptiduria represent some of the best-characterized endophenotypes in autism
research.
Methods: Family-based and case-control association studies were performed on clinical samples drawn from 312
simplex and 29 multiplex families including 371 non-syndromic autistic patients and 156 unaffected siblings, as well as on
171 controls. TPH2 SNPs rs4570625 and rs4565946 were genotyped using the TaqMan assay; GLO1 SNP C419A was
genotyped by PCR and allele-specific restriction digest. Family-based association analyses were performed by TDT and
FBAT, case-control by χ
2
, endophenotypic analyses for 5-HT blood levels, cranial circumference and urinary peptide
excretion rates by ANOVA and FBAT.
Published: 8 March 2007
BMC Medical Genetics 2007, 8:11 doi:10.1186/1471-2350-8-11
Received: 11 August 2006
Accepted: 8 March 2007
This article is available from: http://www.biomedcentral.com/1471-2350/8/11
© 2007 Sacco et al; licensee BioMed Central Ltd.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0),
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Page 1 of 9
(page number not for citation purposes)

BMC Medical Genetics 2007, 8:11 http://www.biomedcentral.com/1471-2350/8/11
Results: TPH2 alleles and haplotypes are not significantly associated in our sample with autism (rs4570625: TDT P =
0.27, and FBAT P = 0.35; rs4565946: TDT P = 0.45, and FBAT P = 0.55; haplotype P = 0.84), with any endophenotype,
or with the presence/absence of prominent repetitive and stereotyped behaviors (motor stereotypies: P = 0.81 and 0.84,
verbal stereotypies: P = 0.38 and 0.73 for rs4570625 and rs4565946, respectively). Also GLO1 alleles display no
association with autism (191 patients vs 171 controls, P = 0.36; TDT P = 0.79, and FBAT P = 0.37), but unaffected siblings
seemingly carry a protective gene variant marked by the A419 allele (TDT P < 0.05; patients vs unaffected siblings TDT
and FBAT P < 0.00001).
Conclusion: TPH2 gene variants are unlikely to contribute to autism or to the presence/absence of prominent repetitive
behaviors in our sample, although an influence on the intensity of these behaviors in autism cannot be excluded. GLO1
gene variants do not confer autism vulnerability in this sample, but allele A419 apparently carries a protective effect,
spurring interest into functional correlates of the C419A SNP.
Background
Autism is a severe disorder of childhood diagnosed on the
basis of impaired social interaction and communication,
presence of rigid and stereotyped behaviors, and disease
onset prior to 3 years of age [1]. Altered prenatal and early-
postnatal neurodevelopment plays a pivotal role in
autism pathogenesis. Microscopic cytoarchitectonic CNS
abnormalities are responsible for the miswiring of neural
pathways and for altered information processing, typi-
cally in the absence of macroscopic neural malformations
or facial dysmorphology [2,3]. Family and twin studies
have conclusively demonstrated prominent genetic con-
tributions to autism, with concordance rates of 82–92%
in monozygotic twins vs 1–10% in dizygotic twins, sibling
recurrence risk at 2–3% vs an incidence of 1–2/1000 in
the general population, and heritability estimates above
90% [4,5]. The identification of these genetic underpin-
nings has proven more complex than anticipated, possi-
bly due to interindividual heterogeneity, epistasis, gene-
environment interactions and epigenetic events [6]. In an
attempt to pin down single-gene contributions, several
investigators have begun selecting candidate genes not
merely based on their chromosomal localization, but also
by linking their cellular function to specific "endopheno-
types" (i.e. heritable clinical, biochemical or morphologi-
cal traits especially frequent among affected individuals
and their first-degree relatives), or by using proteomic
studies of post-mortem brain tissue as a starting point.
Following these approaches, and under the assumption
that single genes may not necessarily yield a detectable
signal in linkage studies of polygenic disorders such as
autism, TPH2 and GLO1 were initially assessed despite a
relative lack of support by sib-pair analyses for their chro-
mosomal localizations (ch. 12q21.1 and 6p21.3-p21.2,
respectively). These initial studies yielded promising evi-
dence supporting TPH2 and GLO1 roles as autism vulner-
ability genes [7,8].
Tryptophan hydroxylase-2 (TPH2) is the recently-discov-
found only in peripheral tissues, except for the pineal
gland [9-11]. Several issues contribute to raise interest in
TPH2 as a candidate gene for autistic disorder: first, 5-HT
exerts prominent neurotrophic roles during development,
in addition to mediating "classical" neurotransmission
[12]; secondly, TPH2 gene variants were found associated
with childhood onset OCD [13], and 5-HT influences
compulsive and/or stereotyped behaviors to the extent
that drugs blocking 5-HT reuptake represent their first-
line treatment not only in OCD but also in autism [14];
thirdly, brain imaging studies have revealed that neural
responsiveness to emotional stimuli in the amydgala is
significantly modulated by TPH2 gene variants [15,16];
finally, one report has provided initial evidence of a pos-
sible association between TPH2 gene variants and autism,
particularly in patients characterized by more severe repet-
itive and stereotyped behaviors [7].
Glyoxalase I (GLO1) has been identified using a pro-
teomic approach on post-mortem brain tissues [8]. Gray
matter samples from brains of autistic patients display
more frequently than unaffected controls a more nega-
tively-charged GLO1 isoform resulting from the single
aminoacid substitution A111E, produced by SNP C419A
[8]. GLO1 is a cytosolic enzyme responsible for the glu-
tathione-dependent detoxification of α-oxoaldehydes,
such as methylglyoxal, spontaneously forming from inter-
mediates of the Embden-Meyerhof glycolytic pathway,
such as glyceraldehyde-3-phosphate and dihydroxyace-
tonephosphate [17]. Interestingly, this initial report also
shows reduced GLO1 enzymatic activity in brain extract
from autistic patients compared to controls, and accumu-
lation of advanced glycation products resulting from low
GLO1 activity [8]. At the genetic level, enhanced frequen-
cies of the A419 allele are found in a small case-control
contrast performed on genomic DNA extracted from the
same brain tissues of patients and controls [8].
The present study attempts to replicate and extend thesePage 2 of 9
(page number not for citation purposes)
ered rate-limiting enzyme for 5-HT synthesis in the CNS,
whereas the "classical" TPH isoform, now termed TPH1, is
findings by using both case-control and family-based
association approaches. We also perform quantitative-

BMC Medical Genetics 2007, 8:11 http://www.biomedcentral.com/1471-2350/8/11
trait analyses employing some of the best-characterized
endophenotypes in autism research, namely cranial cir-
cumference, 5-HT blood levels and urinary peptide excre-
tion rates [18,19]. Indeed, macrocephaly (i.e., cranial
circumference > 97
th
percentile) has been consistently
found in approximately 20% of autistic patients, 5-HT
blood levels are elevated in at least 25% of patients, and
excessive peptiduria is found in up to 60% of cases
depending on ethnicity and country of origin; sizable
familiality and heritability is present for all three parame-
ters ([20-23], and Persico et al, manuscript in preparation
for familiality of peptiduria).
Methods
Subjects
Families were recruited for this study based on the pres-
ence of a proband diagnosed with primary autistic disor-
der (i.e., idiopathic, non-syndromic autism). The
composition of our clinical sample is summarized in
Table 1. Out of this global sample, 210 Italian families
and 24 Caucasian-American families from Arizona were
involved in the TPH2 study, whereas GLO1 was geno-
typed in a partly-overlapping set including 176 Italian
families and all 76 Caucasian-American families availa-
ble. Demographic and clinical characteristics, as well as
inclusion criteria, and diagnostic screening methods used
to exclude probands with syndromic autism have been
previously reported [18]. Briefly, patients fulfilling DSM-
IV diagnostic criteria for Autistic Disorder [1] were
screened for non-syndromic autism using MRI, EEG, audi-
ometry, urinary aminoacid and organic acid measure-
ments, cytogenetic and fragile-X testing. Patients with
dysmorphic features were excluded even in the absence of
detectable cytogenetic alterations. Patients with sporadic
seizures (i.e., < 1 every 6 months) were included; patients
with frequent seizures or focal neurological deficits were
excluded. Autistic behaviors were assessed using the offi-
cial Italian version of the Autism Diagnostic Observation
Schedule (ADOS) and the Autism Diagnostic Interview-
Revised (ADI-R) [24,25]; adaptive functioning was
assessed using the Vineland Adaptive Behavior Scales
(VABS); I.Q. was determined using either the Griffith
Mental Developmental Scales, the Coloured Raven Matri-
ces, the Bayley Developmental Scales or the Leiter Interna-
tional Performance Scale. In addition, a total of 156
unaffected siblings was also assessed, including 128 sib-
lings from simplex families and 28 from multiplex fami-
lies. All parents gave written informed consent for
themselves and for their children, using the consent form
approved by the I.R.B. of U.C.B.M. (Rome, Italy). Finally,
we assessed 180 unaffected Italian controls, including 166
individuals whose blood was drawn at the Laboratory of
the "S. Cuore" Clinic (Rome, Italy), as prescribed by fam-
ily practitioners for a broad range of physical complaints
unrelated to psychiatric disorders, and 14 medical and
nursing students recruited at U.C.B.M. (Rome, Italy).
Markers and genotyping
SNPs rs4570625 and rs4565946 are located in the puta-
tive transcriptional control region [G(-703)T] and in
intron 2 of the TPH2 gene, respectively [13]. These SNPs
were selected because their G-C haplotype is preferentially
transmitted to children and adolescents with OCD [13],
and due to evidence of functional correlates with neural
activity, at least for alleles at SNP rs4570625 [15,16]. SNPs
rs4570625 and rs4565946 were genotyped using the Taq-
Table 1: Composition of the complete sample.
Number of Families Number of Trios
Site Number of Individuals with Autism Simplex Multiplex Complete Incomplete
II University of Naples (Naples, Italy) 121 121 - 107 14
I.R.C.C.S. "Ospedale Bambino-Gesù" (Rome, Italy) 42 42 - 38 4
I.R.C.C.S. "Oasi Maria S.S." (Troina, Italy) 42 40 1 41 1
U.C.B.M. (Rome, Italy) 21 21 - 21 -
II University of Rome (Rome, Italy) 22 20 1 21 -
University of Milan (Milan, Italy) 15 15 - 15 -
University of Turin (Turin, Italy) 4 4 - 4 -
Italian Families 267 263 2 247 19
A.G.R.E. Consortium 60 15 23* 38 -
Southwest Autism Research Center (Phoenix, AZ) 44 34 4 38 -
Caucasian-American Families 104 49 27 76 -
Total Sample 371 312 29 323 19Page 3 of 9
(page number not for citation purposes)
*DNA was not available for one of the two affected children from one multiplex family from the A.G.R.E. Consortium. This family is still listed as
"multiplex" in the table.

BMC Medical Genetics 2007, 8:11 http://www.biomedcentral.com/1471-2350/8/11
Man method (Applied Biosystems, Foster City, CA),
according to the manufacturer's guidelines. The following
primers were used:
rs4570625
forward primer: ACACTCACACATTTGCATGCAC
reverse primer: CATTGACCAACTCCATTTTATGT-
TAATAAGCT
reporter 1 (VIC) sequence: CTTGACATATTCTAATTTT
reporter 2 (FAM) sequence: ACTTGACATATTATAATTTT
rs4565946:
forward primer: TCACTCTGCCATCAGCTAGTCA
reverse primer: CTGAGGTCCAGATGGGTTAAATGG
reporter 1(VIC) sequence: CTTAGCTAAGGCCCCG
reporter 2 (FAM) sequence: CTTAGCTAAGACCCCG
The PCR amplification protocol for the TaqMan assays
includes denaturation at 95°C for 10 min, followed by 40
cycles at 92°C for 15 sec, 60°C for 1 min, and 72°C for 45
sec, followed by elongation at 72°C for 5 min. The Taq-
Man assays were then read on a 7900HT Fast Real-Time
PCR System and alleles were called using the SDS software
(Applied Biosystems, Foster City, CA).
The GLO1 SNP C419A was genotyped by PCR amplifica-
tion of genomic DNA (80 ng) using the following primers
GLO1-F [5'-TGTCCAGTACCTGTATTTACTG-3'] and
GLO1-R [5'-GCAAACTTACCGAATCCTCG-3']. The PCR
amplification protocol includes denaturation at 95°C for
3 min, followed by 35 cycles at 95°C for 30 sec, 57°C for
30 sec, and 72°C for 45 sec, followed by elongation at
72°C for 5 min. The PCR product was cut with BSMAI (5
U) at 55°C overnight and run in 2% agarose or 5% acry-
lamide gels, yielding different restriction patterns for the
C allele (259 bp + 36 bp) and the A allele (198 bp + 61 bp
+ 36 bp). An alternative restriction pattern was also iden-
tified (C = 295 bp, A = 234 bp + 61 bp) in 3/171 (1.8%)
controls, as well as in one father and in one unaffected sib-
ling.
Endophenotype measures
Blood samples for 5-HT levels were obtained from all
family members and centrifuged within 20 min of veni-
puncture at 140 g for 25 min at 4°C; 1 ml of supernatant
excretion analysis was performed by HPLC on the first
morning urine samples of all family members, as
described [23]. The total area of peaks under the 215 nm
absorption curve (AUC) in the peptide region following
the hippuric acid peak was calculated and expressed in
μm
2
. Head circumference was measured in autistic
patients and unaffected siblings by trained physicians
using a non-stretchable plastic measuring tape graded in
millimeters, placed over the maximum fronto-occipital
head perimeter [18].
Data analysis
Hardy-Weinberg analyses were performed using the HWE
program of the LINKUTIL software package [26]. Case-
control allelic and genotypic distributions were contrasted
using the χ
2
statistics, following randomized selection of
one patient per multiplex family. Single-marker and hap-
lotype family-based association analyses were performed
applying the transmission/disequilibrium test (TDT) [27]
using the TDTPHASE software of the UNPHASED package
[28]; only complete trios and one trio per multiplex fam-
ily were included in these analyses. Furthermore, family-
based association analyses were also performed using the
FBAT software, which emphasizes contrasts between sib-
lings allowing to fully use the genetic information pro-
vided by multiplex families [29,30]. All family-based
association analyses were carried out on Italian and Cau-
casian-American families merged together, after popula-
tion structure analyses provided no evidence of genetic
dyshomogeneity in a subgroup of 179 autistic patients
including 155 Italians and 24 Caucasian-Americans indi-
viduals randomly chosen one per family, genotyped at
ninety unlinked SNPs distributed genome-wide and ana-
lyzed using the STRUCTURE program [31]. Since these
stratification analysis did not include unaffected controls,
case-control contrasts employed only individuals of Ital-
ian ancestry. Data are expressed as mean ± S.E.M., except
for head circumference and urinary peptide excretion
rates, expressed as median ± semi-interquartilic range
(I.Q.R.). Head circumference measures were transformed
into percentiles using sex- and age-specific standard tables
[32,33]. Two-tail P values are reported.
Results
TPH2
Both rs4570625 and rs4565946 are in Hardy-Weinberg
equilibrium in autistic patients and in their first-degree
relatives (data not shown). The two SNPs are in strong
linkage disequilibrium (D' = 0.91, P < 0.001), as previ-
ously found in other samples [13]. Both TDT and FBAT
analyses, presented in table 2, provide no evidence of sig-
nificant association with autism either for single markers,
or for two-marker haplotypes (global P-value for haplo-Page 4 of 9
(page number not for citation purposes)
(i.e., platelet-rich plasma) was stored at -80°C and
assessed by HPLC, as described [22]. Urinary peptide
type analysis = 0.84). Single-marker FBAT analyses show
no trend towards possible associations with endopheno-

BMC Medical Genetics 2007, 8:11 http://www.biomedcentral.com/1471-2350/8/11
typic quantitative traits including cranial circumference
(rs4570625: P = 0.16; rs4565946: P = 0.13), and urinary
peptide excretion rates (rs4570625: P = 0.16; rs4565946:
P = 0.52)(table 3). A non-significant trend towards higher
5-HT blood levels is seen in patients carrying TPH2 alleles
G and C at rs4570625 and rs4565946, respectively (table
3) (rs4570625: P = 0.0504; rs4565946: P = 0.69). Finally,
TPH2 gene variants marked by these two SNPs also do not
seem to influence whether at the time of clinical intake
autistic patients display prominent motor or verbal stere-
otypies (table 4). Identically negative outcomes are also
obtained performing single-marker FBAT analyses on sub-
sets of families selected for probands displaying motor
stereotypies (rs4570625: N = 66, P = 0.58; rs4565946: N
= 77, P = 0.92), no motor stereotypies (rs4570625: N = 37,
P = 0.75; rs4565946: N = 35, P = 0.61), or with verbal/
vocal stereotypies (rs4570625: N = 34, P = 0.43;
rs4565946: N = 47, P = 0.53), or no verbal/vocal stereo-
typies (rs4570625: N = 75, P = 0.69; rs4565946: N = 73, P
= 0.77).
GLO1
The GLO1 C419A SNP is in Hardy-Weinberg equilibrium
in autistic patients and in their first-degree relatives (data
not shown). Case-control, TDT and FBAT analyses pro-
vide no evidence of association between C419A alleles
and autism (table 5). Furthermore, there is no trend
towards an association with serotonin blood levels
(informative families N = 93, FBAT P = 0.17), cranial cir-
cumference (N = 96, P = 0.43), and urinary peptide excre-
tion rates (N = 115, P = 0.96) (table 3). However, TDT
analyses support the existence of a protective A419 variant
that is preferentially transmitted to unaffected siblings,
particularly from the paternal side (table 5). Single-
marker FBAT analyses display only a non-significant trend
in this direction, possibly due to small sample size, but
confirm a highly significant divergence in allelic transmis-
sion probabilities between autistic patients and unaf-
fected siblings at this locus (P < 1 × 10
-5
, table 5).
Discussion
The present study provides evidence that TPH2 and GLO1
gene variants do not contribute significantly to autism
pathogenesis in our sample, while GLO1 could seemingly
exert a protective effect in unaffected siblings. Our conclu-
sions are strengthened by the consistency of multiple sta-
tistical approaches and by the parallel assessment of some
of the most reliable biochemical and morphological
endophenotypes described in autism research to this date,
namely macrocephaly, hyperserotoninemia and
enhanced peptiduria [20-23]. These heritable traits are
believed to be more directly linked to the genetic make-up
of an individual than complex clinical symptoms, and
processes. These parameters were thus chosen on this
ground, and not following a-priori hypotheses. In particu-
lar, 5-HT blood levels do not reflect TPH2 activity, as
peripheral 5-HT largely comes from the digestive tract and
is thus produced by TPH1 [9-11]. Therefore, the non-sig-
nificant trend towards an association between TPH2 gene
variants and 5-HT blood levels either represents a spuri-
ous finding, or necessarily stems from an indirect patho-
physiological link which will require further
investigation.
Some differences must be drawn in the interpretation of
the data pertaining to TPH2 and GLO1. Our results
exclude causal TPH2 roles in our sample, and do not sup-
port the hypothesis that TPH2 gene variants may exert a
major influence on repetitive and stereotypic behaviors in
autistic patients. This conclusion confirms the outcome of
a recent study, reporting no association either with
autism, or with obsessive-compulsive and self-stimulatory
behaviors in autistic patients [34]. Collectively, these find-
ings, although negative, are important due to the relevant
roles played by 5-HT during neurodevelopment [12], and
because they help us interpret contributions to autism by
serotoninergic genes. TPH2 and the 5-HT transporter (5-
HTT) play pivotal roles in central serotoninergic neuro-
transmission. TPH2 determines the rate of 5-HT biosyn-
thesis in the CNS [9-11], whereas the 5-HTT terminates
the action of extracellular 5-HT on its receptors through
reuptake [35]. During neurodevelopment, 5-HT exerts
impressive neurotrophic effects on cell proliferation, dif-
ferentiation, and migration, programmed cell death, cell-
cell coupling, synaptogenesis and cytoskeletal plasticity
[12]. Many of these processes appear altered in neu-
ropathological studies of autistic brains [2,3]. Further-
more, a recent quantitative brain imaging study has
revealed increased cortical gray matter volumes in autistic
patients carrying 5-HTT gene variants yielding slower
extracellular 5-HT clearance rates, resulting in higher
extracellular 5-HT levels [36]. This finding parallels results
obtained in 5-HTT knockout mice backcrossed into
C57BL/6J, displaying increased neuronal cell density and
thickness of supragranular and infragranular neocortical
layers compared to wild-type mice [37]. In contrast to
these neurobiological data, strongly supporting the
trophic effects exerted by elevated extracellular 5-HT levels
in autism, results of genetic studies on serotoninergic gene
variants in autism are mostly negative or mixed at best.
Indeed, the present and prior studies jointly indicate that
(a) in the vast majority of cases, functional serotoninergic
gene variants play a modulatory, but not a causal role in
autism; (b) 5-HT synthesis does not contribute to produce
increased levels and/or prolonged persistence of extracel-
lular 5-HT, which largely stems from reduced 5-HT uptakePage 5 of 9
(page number not for citation purposes)
could thus possibly identify subgroups of autistic patients
characterized by relatively homogenous pathogenetic
and could possibly play a role in eccessive neurotrophism
and macrocephaly in autism; (c) 5-HT could modulate

BMC Medical Genetics 2007, 8:11 http://www.biomedcentral.com/1471-2350/8/11
not only morphological features such as head circumfer-
ence, but also repetitive and stereotypic behaviours in
autism, as well as in OCD [7,13,14,38]. Unfortunately the
approved Italian translation of the Autism Diagnostic
Interview-Revised (ADI-R) has become available only
recently [25], and this instrument was not available when
the vast majority of our sample was recruited. However,
the presence/absence of relevant verbal and motor stereo-
typic behaviors that was assessed here by an experienced
clinician at intake largely corresponds to the current pres-
ence of "stereotyped utterances and delayed echolalia",
"hand and finger mannerisms", "other complex manner-
isms or stereotyped body movements", and "midline
hand movements", as assessed by ADI-R items n. 33, 77,
78, and 79, respectively [25]. Therefore, despite represent-
ing a crude, single time-point measure, it allows us to
exclude prominent roles for TPH2 gene variants in these
behavioural symptoms. Searches for modulatory effects
on repetitive and stereotypic behaviors will require finer,
possibly longitudinal measures.
On the other hand, GLO1 allele A419 seemingly exerts a
protective effect among unaffected siblings, whose allelic
transmission patterns differ significantly from those of
their autistic siblings, both using TDT and FBAT. The dis-
crepancy between initial findings by Junaid and Col-
Table 3: Serotonin blood levels, urinary peptide excretion rates, and head circumference by TPH2 and GLO1 genotypes. *
TPH2 AUTISTIC PATIENTS – RS4570625 AUTISTIC PATIENTS – RS4565946
GG GT TT Statistics CC CT TT Statistics
Serotonin Blood
Levels (ng/ml)
352.4 ± 35.7
(90)
293.8 ± 40.7
(39)
261.2 ± 57.0
(6)
F = 0.642 (2,132
df), P = 0.53
377.4 ± 64.9
(42)
328.2 ± 33.2
(58)
289.1 ± 42.1
(32)
F = 0.742 (2,129
df), P = 0.48
Urinary Peptides
(AUC in μm
2
)
309.5 ± 122
(80)
297.5 ± 97.5
(42)
332.0
(2)
K-W χ
2
= 3.340,
2 df, P = 0.19
306.0 ± 127.5
(33)
298.0 ± 86.5
(57)
296.0 ± 150
(32)
K-W χ
2
= 0.172,
2 df, P = 0.92
Head
Circumference
(percentile)
82.5 ± 23.7
(97)
82.5 ± 17.5
(57)
50.0 ± 24
(6)
K-W χ
2
= 2.324,
2 df, P = 0.31
75.0 ± 23.7
(42)
75.0 ± 23.7
(72)
90.0 ± 23.7
(42)
K-W χ
2
= 0.958,
2 df, P = 0.62
GLO1 AUTISTIC PATIENTS UNAFFECTED SIBLINGS
AA AC CC Statistics AA AC CC Statistics
Serotonin Blood
Levels (ng/ml)
213.2 ± 22.5
(49)
208.5 ± 11.7
(76)
244.3 ± 24.2
(29)
F = 0.857 (2,153
df), P = 0.43
201.0 ± 33.5
(22)
189.8 ± 29.4
(18)
177.8 ± 20.9
(10)
F = 0.111 (2,49
df), P = 0.90
Urinary Peptides
(AUC in μm
2
)
324.0 ± 110
(55)
313.0 ± 120
(85)
319.0 ± 132
(37)
K-W χ
2
= 0.711,
2 df, P = 0.70
212.5 ± 65
(26)
196.0 ± 98
(25)
290.0 ± 146.5
(15)
K-W χ
2
= 1.363,
2 df, P = 0.51
Head
Circumference
(percentile)
82.5 ± 17.5
(63)
82.5 ± 23.8
(99)
75.0 ± 33.2
(40)
K-W χ
2
= 1.325,
2 df, P = 0.52
86.3 ± 19.1
(22)
82.5 ± 23.8
(22)
82.5 ± 31.6
(10)
K-W χ
2
= 0.788,
2 df, P = 0.67
Table 2: TDT and FBAT analyses of SNPs rs4570625 and rs4565946, and relative haplotypes at the TPH2 locus.*
TDT TPH2 – RS4570625 TPH2 – rs4565946 HAPLOTYPES RS4570625-RS4565946
N = 224 complete trios N = 219 complete trios Haplotype T NT χ
2
(1df) P-value
G Transmitted 88 χ
2
= 1.21(1 df), P = 0.27 C Transmitted 107 χ
2
= 0.57(1 df), P = 0.45 G-C 73 72 0.01 0.92
T Transmitted 77 T Transmitted 116 G-T 87 74 1.05 0.31
T-C 51 63 1.26 0.26
T-T 1 3 1.00 0.32
FBAT Allele N. of families S E(S) Var(S) Z P
rs4570625 G 136 194.000 188.000 42.000 0.926 0.35
T 136 84.000 90.000 42.000 -0.926
rs4565946 C 166 161.000 165.500 57.750 -0.592 0.55
T 166 183.000 178.500 57.750 0.592
Haplotypes (Estimated Freq)
G-T (0.486) 160.9 195.112 190.637 56.686 0.594 0.55
G-C (0.296) 154.0 127.888 126.863 48.312 0.147 0.88
T-C (0.211) 125.4 78.112 83.137 39.218 -0.802 0.42
T-T (0.008) 6.7 - - - - -
*FBAT analyses are performed under an additive model [29,30]. P-values are rounded to the second digit.Page 6 of 9
(page number not for citation purposes)
* Data are expressed as mean ± S.E.M. for serotonin blood levels, and median ± semi-interquartilic range for amounts of urinary peptides and head
circumference; 2-tail P-values are reported. Sample sizes are shown in italics; K-W = Kruskal-Wallis non-parametric ANOVA.

BMC Medical Genetics 2007, 8:11 http://www.biomedcentral.com/1471-2350/8/11
leagues [8], proposing A419 as an autism vulnerability
allele, and our findings may stem from at least two poten-
tial sources. First, it is important to notice that the A419
allele frequencies found by Junaid and Colleagues [8] in
autistic patients are very similar to those reported here
(0.6056 vs 0.5785 and 0.5693 in our Italian and Cauca-
sian-American patients, respectively), whereas their con-
trol allele frequencies are much lower than those found in
our controls (0.4400 vs 0.5439). It is likely that a small
sample size including only 50 controls, encompassing
Table 5: Case-control, TDT and FBAT (additive model) analyses of SNP C419A (A111E) at the GLO1 locus.
CASE-CONTROL ITALIAN PATIENTS
(N = 191)
ITALIAN CONTROLS
(N = 171)
U.S. PATIENTS
(N = 101)
ITALIAN
PATIENTS
(chr N = 382)
ITALIAN
CONTROLS
(chr N = 342)
U.S. PATIENTS
(chr N = 202)
A/A 67 (35.1%) 52 (30.4%) 34 (33.7%) A 221 (.5785) 186 (.5439) 115 (.5693)
A/C 87 (45.5%) 82 (48.0%) 47 (46.5%) C 161 (.4215) 156 (.4561) 87 (.4307)
C/C 37 (19.4%) 37 (21.6%) 20 (19.8%)
Italian patient vs control genotypes χ
2
= 0.94, 2 df, P = 0.63 Italian patient vs control alleles χ
2
= 0.88, 1 df, P = 0.36
TDT Autistic Patients Unaffected Siblings
N = 236 complete trios N = 100 complete trios Maternal transmissions Paternal transmissions
A Transmitted 105 χ
2
= 0.074(1df),
P = 0.79
56 χ
2
= 4.35(1df),
P < 0.05
21 χ
2
= 1.00(1df),
P = 0.32
26 χ
2
= 5.16(1df),
P < 0.05
C Transmitted 109 36 15 12
TDT autistic patients vs unaffected siblings: χ
2
= 24.48 (1df), P < 0.000001
FBAT Allele N. of families S E(S) Var(S) Z P
Autistic Patients A 170 199.000 206.000 61.500 -0.893 0.37
C 170 189.000 182.000 61.500 0.893
Unaffected Siblings A 77 111.000 103.000 30.000 1.461 0.14
C 77 75.000 83.000 30.000 -1.461
Table 4: TPH2 alleles in autistic patients with(+) or without (-) motor stereotypies (MS) or verbal stereotypies (VS).
SNP Allele AUTISTIC PATIENTS CONTROLS*
M.S. PRESENT M.S. ABSENT V.S. PRESENT V.S. ABSENT
rs4570625 G 104/148 (70.3%) 37/54 (68.5%) 60/82 (73.2%) 74/110 (67.3%) 206/268 (76.9%)
T 44/148 (29.7%) 17/54 (31.5%) 22/82 (26.8%) 36/110 (32.7%) 62/268 (23.1%)
statistics M.S. + vs -: χ
2
= 0.06, 1 df, P = 0.81 V.S. + vs -: χ
2
= 0.78 1 df, P = 0.38
M.S. + vs Controls: χ
2
= 2.18, 1 df, P = 0.14 V.S. + vs Controls:χ
2
= 0.47, 1 df, P = 0.49
M.S. - vs Controls: χ
2
= 1.69, 1 df, P = 0.19 V.S. - vs Controls:χ
2
= 3.74, 1 df, P = 0.053
rs4565946 C 79/153 (51.6%) 34/64 (53.1%) 51/95 (53.7%) 58/113 (51.3%) 156/268 (58.2%)
T 74/153 (48.4%) 30/64 (46.9%) 44/95 (46.3%) 55/113 (48.7%) 112/268 (41.8%)
statistics M.S. + vs -: χ
2
= 0.04 1 df, P = 0.84 V.S. + vs -: χ
2
= 0.11, 1 df, P = 0.73
M.S. + vs Controls: χ
2
= 1.71, 1 df, P = 0.19 V.S. + vs Controls: χ
2
= 0.59, 1 df, P = 0.44
M.S. - vs Controls: χ
2
= 0.55, 1 df, P = 0.46 V.S. - vs Controls: χ
2
= 1.53, 1 df, P = 0.22
Haplotypes Estimated Frequency in M.S. and/or V.S. present Estimated Frequency in M.S. and/or V.S. absent
G-C 0.3271 0.3065
G-T 0.458 0.4516
T-C 0.201 0.2419
T-T 0.014 -
Likelihood ratio test: null = -232.5, alternative = -232, LRS = 1.034, 3 df, P = 0.59
*Allelic frequencies for controls are from ref 13.Page 7 of 9
(page number not for citation purposes)
FBAT autistic patients vs unaffected siblings: Z = 17.44, P < 0.00001

BMC Medical Genetics 2007, 8:11 http://www.biomedcentral.com/1471-2350/8/11
both normal subjects and patients with Batten disease or
fragile-X syndrome instead of randomly chosen unaf-
fected individuals, may have diminished the reliability of
allele frequency estimates in the general population,
skewing case-control statistics [8]. The definition of A419
as a risk allele for autism would thus not seem fully justi-
fied already on the basis of the genetic data set presented
in the initial study [8]. Secondly, the present study is the
first one including also unaffected siblings, which were
not assessed previously [8]. The existence of significant
differences in allelic transmission rates between our autis-
tic patients and unaffected siblings does point towards the
existence of functional GLO1 gene variants, deserving fur-
ther characterization in order to understand their protec-
tive role in families with an autistic proband. These
variants may be represented by the A419 allele itself, but
could also consist in polymorphisms located in the tran-
scriptional regulatory regions of the GLO1 gene and in
linkage disequilibrium with the C419A SNP. This possi-
bility is consistent with the decreased glyoxalase I enzy-
matic activity found in post-mortem neocortical tissues of
autistic patients, as compared to controls [8].
Conclusion
Based on the consistency between case-control and fam-
ily-based association analyses, we can exclude in our sam-
ple a major role for TPH2 gene variants in autism
pathogenesis, and in determining the presence of promi-
nent repetitive and stereotypic behaviors assessed at the
time of patient recruitment by an experienced clinician.
Our study cannot exclude that functional TPH2 gene var-
iants may influence the intensity and course of repetitive
and stereotypic behaviors in the longer term. Also GLO1
protein variants encoded by the C419A SNP seemingly do
not confer autism vulnerability in this sample, but allele
A419 apparently carries a protective effect among unaf-
fected siblings, spurring further interest into the func-
tional correlates of the C419A SNP and of other
polymorphisms located in transcriptional regulatory
regions of this gene.
List of abbreviations
5-HT, serotonin; 5-HTT, serotonin transporter; CNS, cen-
tral nervous system; FBAT, family-based association test;
GLO1, glyoxalase I; K-W, Kruskal-Wallis non parametric
ANOVA; MS, motor stereotypies; OCD, obsessive-com-
pulsive disorder; SNP, single nucleotide polymorphism;
TDT, transmission/disequilibrium test; TPH2, tryptophan
hydroxylase-2; VS, verbal stereotypies.
Competing interests
The author(s) declare that they have no competing inter-
ests.
Authors' contributions
RS participated in study design and performed the statisti-
cal analyses, VP carried out GLO1 genotypings, JH and FR
performed TPH2 genotypings and commented on the
manuscript, RMoe participated in study design for TPH2.
Patient recruitment, clinical assessment and sample col-
lections were performed by RMi and CB in Naples, PC,
BM and ST in Rome, CS and RMe in Phoenix, ME in
Troina. TP and SPA measured 5-HT blood levels, KLR
determined urinary peptide excretion rates, and AMP con-
tributed to study design, coordinated recruitment and
data collection, and drafted the manuscript. Authors read
and approved the final manuscript.
Acknowledgements
This work was supported by the National Alliance for Autism Research
(Princeton, NJ), Telethon-Italy (GGP02019), the Fondation Jerome Lejeune
(Paris, France), and the Cure Autism Now Foundation (Los Angeles, Cali-
fornia). The authors gratefully acknowledge Elisa Astorri, Elena Caporali,
Enrica Fiori, Federica Giambattistelli and Francesca Mastrolilli for technical
assistence, all the families who participated in this study, and the resources
provided by the AGRE Consortium.
References
1. American Psychiatric Association: Diagnostic and Statistical Manual of
Mental Disorders 4th edition. Washington D.C., American Psychiatric
Association; 1994.
2. Pickett J, London E: The neuropathology of autism: a review. J
Neuropathol Exp Neurol 2005, 64:925-935.
3. DiCicco-Bloom E, Lord C, Zwaigenbaum L, Courchesne E, Dager SR,
Schmitz C, Schultz RT, Crawley J, Young LJ: The developmental
neurobiology of autism spectrum disorder. J Neurosci 2006,
26:6897-6906.
4. Folstein SE, Rosen-Sheidley B: Genetics of autism: complex aeti-
ology for a heterogeneous disorder. Nat Rev Genet 2001,
2:943-955.
5. Veenstra-VanderWeele J, Cook EH Jr: Molecular genetics of
autism spectrum disorder. Mol Psychiatry 2004, 9:819-832.
6. Persico AM, Bourgeron T: Searching for ways out of the autism
maze: genetic, epigenetic and environmental clues. Trends
Neurosci 2006, 29:349-358.
7. Coon H, Dunn D, Lainhart J, Miller J, Hamil C, Battaglia A, Tancredi
R, Leppert MF, Weiss R, McMahon W: Possible association
between autism and variants in the brain-expressed tryp-
tophan hydroxylase gene (TPH2). Am J Med Genet B Neuropsy-
chiatr Genet 2005, 135:42-46.
8. Junaid MA, Kowal D, Barua M, Pullarkat PS, Sklower Brooks S, Pullar-
kat RK: Proteomic studies identified a single nucleotide poly-
morphism in glyoxalase I as autism susceptibility factor. Am
J Med Genet A 2004, 131:11-17.
9. Walther DJ, Bader M: A unique central tryptophan hydroxylase
isoform. Biochem Pharmacol 2003, 66:1673-1680.
10. Walther DJ, Peter JU, Bashammakh S, Hortnagl H, Voits M, Fink H,
Bader M: Synthesis of serotonin by a second tryptophan
hydroxylase isoform. Science 2003, 299:76.
11. Zhang X, Beaulieu JM, Sotnikova TD, Gainetdinov RR, Caron MG:
Tryptophan hydroxylase-2 controls brain serotonin synthe-
sis. Science 2004, 305:217.
12. Di Pino G, Moessner R, Lesch KP, Lauder JM, Persico AM: Roles for
serotonin in neurodevelopment: more than just neural
transmission. Curr Neuropharmacol 2004, 2:403-418.
13. Mossner R, Walitza S, Geller F, Scherag A, Gutknecht L, Jacob C,
Bogusch L, Remschmidt H, Simons M, Herpertz-Dahlmann B, Fleis-
chhaker C, Schulz E, Warnke A, Hinney A, Wewetzer C, Lesch KP:
Transmission disequilibrium of polymorphic variants in the
tryptophan hydroxylase-2 gene in children and adolescentsPage 8 of 9
(page number not for citation purposes)
with obsessive-compulsive disorder. Int J Neuropsychopharmacol
2006, 9:437-442.

Publish with BioMed Central and every
scientist can read your work free of charge
"BioMed Central will be the most significant development for
disseminating the results of biomedical research in our lifetime."
Sir Paul Nurse, Cancer Research UK
Your research papers will be:
available free of charge to the entire biomedical community
peer reviewed and published immediately upon acceptance
cited in PubMed and archived on PubMed Central
BMC Medical Genetics 2007, 8:11 http://www.biomedcentral.com/1471-2350/8/11
14. Kolevzon A, Mathewson KA, Hollander E: Selective serotonin
reuptake inhibitors in autism: a review of efficacy and toler-
ability. J Clin Psychiatry 2006, 67:407-414.
15. Canli T, Congdon E, Gutknecht L, Constable RT, Lesch KP: Amy-
gdala responsiveness is modulated by tryptophan hydroxy-
lase-2 gene variation. J Neural Transm 2005, 112:1479-1485.
16. Herrmann MJ, Huter T, Muller F, Muhlberger A, Pauli P, Reif A, Ren-
ner T, Canli T, Fallgatter AJ, Lesch KP: Additive Effects of Serot-
onin Transporter and Tryptophan Hydroxylase-2 Gene
Variation on Emotional Processing. Cereb Cortex 2006. Epub
ahead of print
17. Thornalley PJ: Glyoxalase I–structure, function and a critical
role in the enzymatic defence against glycation. Biochem Soc
Trans 2003, 31:1343-1348.
18. Conciatori M, Stodgell CJ, Hyman SL, O'Bara M, Militerni R, Bravaccio
C, Trillo S, Montecchi F, Schneider C, Melmed R, Elia M, Crawford L,
Spence SJ, Muscarella L, Guarnieri V, D'Agruma L, Quattrone A,
Zelante L, Rabinowitz D, Pascucci T, Puglisi-Allegra S, Reichelt KL,
Rodier PM, Persico AM: Association between the HOXA1
A218G polymorphism and increased head circumference in
patients with autism. Biol Psychiatry 2004, 55:413-419.
19. D'Amelio M, Ricci I, Sacco R, Liu X, D'Agruma L, Muscarella LA,
Guarnieri V, Militerni R, Bravaccio C, Elia M, Schneider C, Melmed R,
Trillo S, Pascucci T, Puglisi-Allegra S, Reichelt K-L, Macciardi F,
Holden JJA, Persico AM: Paraoxonase gene variants are associ-
ated with autism in North America, but not in Italy: possible
regional specificity in gene-environment interactions. Mol
Psychiatry 2005, 10:1006-1016.
20. Fombonne E, Rogé B, Claverie J, Courty S, Frémolle J: Microcephaly
and macrocephaly in autism. J Autism Dev Disord 1999,
29:113-119.
21. Fidler DJ, Bailey JN, Smalley SL: Macrocephaly in autism and
other pervasive developmental disorders. Dev Med Child Neurol
2000, 42:737-740.
22. Piven J, Tsai GC, Nehme E, Coyle JT, Chase GA, Folstein SE: Platelet
serotonin, a possible marker for familial autism. J Autism Dev
Disord 1991, 21:51-59.
23. Reichelt WH, Knivsberg AM, Nodland M, Stensrud M, Reichelt KL:
Urinary peptide levels and patterns in autistic children from
seven countries, and the effect of dietary intervention after
4 years. Dev Brain Dysfunct 1997, 10:44-55.
24. Lord C, Rutter M, DiLavore PC, Risi S: ADOS, Autism Diagnostic Obser-
vation Schedule Los Angeles, Western Psychological Services; 2002.
(Italian version ed. by Tancredi R, Saccani M, Persico AM, Parrini B,
Igliozzi R and Faggioli R. Firenze, Organizzazioni Speciali 2005)
25. Rutter M, Le Couter A, Lord C: ADI-R, Autism Diagnostic Interview –
Revised Los Angeles, Western Psychological Services; 2003. (Italian
version ed. by Faggioli R, Saccani M, Persico AM, Tancredi R, Parrini
B and Igliozzi R. Firenze, Organizzazioni Speciali 2005)
26. HWE program [http://www.genemapping.cn/linkutil.htm]
27. Spielman RS, Ewens WJ: The TDT and other family-based tests
for linkage disequilibrium and association. Am J Hum Genet
1996, 59:983-989.
28. UNPHASED software [http://portal.litbio.org/Registered/
Option/unphased.html]
29. Horvath S, Xu X, Laird NM: The family based association test
method: strategies for studying general genotype-phenotype
associations. Eur J Hum Genet 2001, 9:301-306.
30. FBAT software [http://www.biostat.harvard.edu/~fbat/fbat.htm]
31. Pritchard JK, Stephens M, Donnelly P: Inference of population
structure using multilocus genotype data. Genetics 2000,
155:945-959.
32. Hamill PVV, Drizd TA, Johnson CL, Reed RB, Roche AF, Moore WM:
Physical growth: National Canter for Health Statistics per-
centiles. Am J Clin Nutr 1979, 32:607-629.
33. Bushby KMD, Cole T, Matthews JNS, Goodship JA: Centiles for
adult head circumference. Arch Dis Child 1992, 67:1286-1287.
34. Ramoz N, Cai G, Reichert JG, Corwin TE, Kryzak LA, Smith CJ, Sil-
verman JM, Hollander E, Buxbaum JD: Family-based association
study of TPH1 and TPH2 polymorphisms in autism. Am J Med
Genet B Neuropsychiatr Genet 2006, 141:861-867.
35. Murphy DL, Li Q, Engel S, Wichems C, Andrews A, Lesch KP, Uhl G:
Genetic perspectives on the serotonin transporter. Brain Res
Bull 2001, 56:487-494.
36. Wassink TH, Cody H, Mosconi M, Epping E, Piven J: Cortical and
Amygdala Overgrowth in Autism Associated with 5-
HTTLPR. Neuropsychopharmacol 2005, 30:S116.
37. Altamura C, Dell'Acqua ML, Moessner R, Murphy DL, Lesch KP, Per-
sico AM: Altered neocortical cell density and layer thickness
in serotonin transporter knockout mice: a quantitation
study. Cereb Cortex 2006 in press.
38. Sutcliffe JS, Delahanty RJ, Prasad HC, McCauley JL, Han Q, Jiang L, Li
C, Folstein SE, Blakely RD: Allelic heterogeneity at the serot-
onin transporter locus (SLC6A4) confers susceptibility to
autism and rigid-compulsive behaviors. Am J Hum Genet 2005,
77:265-279.
Pre-publication history
The pre-publication history for this paper can be accessed
here:
http://www.biomedcentral.com/1471-2350/8/11/prepubyours — you keep the copyright
Submit your manuscript here:
http://www.biomedcentral.com/info/publishing_adv.asp
BioMedcentral
Page 9 of 9
(page number not for citation purposes)