Hindawi Publishing Corporation
Journal of Oncology
Volume 2010, Article ID 939407, 10 pages
doi:10.1155/2010/939407
Research Article
CXCL7-Mediated Stimulation of Lymphangiogenic Factors
VEGF-C, VEGF-D in Human Breast Cancer Cells
Minghuan Yu,
1
Richard Berk,
2
andMary Ann Kosir
1, 3, 4
1
Department of Surgery, Wayne State University, Detroit, MI 48201, USA
2
Department of Immunology and Microbiology, Wayne State University, Detroit, MI 48201, USA
3
Surgical Service, John D. Dingell VA Medical Center, Detroit, MI 48201, USA
4
Breast Biology Program, Karmanos Cancer Institute, Detroit, MI 48201, USA
Correspondence should be addressed to Mary Ann Kosir, kosirm@karmanos.org
Received 1 November 2009; Revised 27 March 2010; Accepted 3 May 2010
Academic Editor: Arkadiusz Dudek
Copyright © 2010 Minghuan Yu et al. This is an open access article distributed under the Creative Commons Attribution License,
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Increased expression of lymphangiogenesis factors VEGF-C/D and heparanase has been correlated with the invasion of cancer.
Furthermore, chemokines may modify matrix to facilitate metastasis, and they are associated with VEGF-C and heparanase. The
chemokine CXCL7 binds heparin and the G-protein-linked receptor CXCR2. We investigatedthe effect of CXCR2 blockade on the
expression of VEGF-C/D, heparanase, and on invasion. CXCL7 siRNA and a specific antagonist of CXCR2 (SB225002) were used
to treat CXCL7 stably transfected MCF10AT cells. Matrigel invasion assays were performed. VEGF-C/D expression and secretion
were determined by real-time PCR and ELISA assay, and heparanase activity was quantified by ELISA. SB225002 blocked VEGF-
C/D expression and secretion (P<.01). CXCL7 siRNA knockdown decreased heparanase (P<.01). Both SB225002 and CXCL7
siRNA reduced the Matrigel invasion (P<.01). The MAP kinase signaling pathway was not involved. The CXCL7/CXCR2 axis is
important for cell invasion and the expression of VEGF-C/D and heparanase, all linked to invasion.
1. Introduction
Breast cancer is the most common malignancy in women,
and metastasis is the number one cause of mortality in breast
cancer [1]. Breast cancer treatments that target the steps of
metastasis are needed. An important part of metastasis is
invasion [2, 3]. Invasion depends in part on degradation of
extracellular matrix (ECM) and interaction with molecules
formed in the process. Recently, increasing attention has
been paid to chemokines that may modify breast cancer
cells and the surrounding matrix to facilitate metastasis. Fur-
thermore, there is evidence that chemokines, VEGF-C, and
heparanase are interrelated in the process of invasion [4–6].
Increased expression of the lymphangiogenesis factors and
heparanase has been correlated with progressive disease in
certain cancers [6]. Peritumoral lymphangiogenesis involves
the secretion of specific glycoproteins designated vascular
endothelial growth factor C (VEGF-C) and (VEGF-D) that
act on lymphatic endothelium, and are components of an
established signaling system for tumor lymphangiogenesis
[7]. Increased lymph node metastases are correlated with
increased expression of VEGF-D and VEGFR3 by immuno-
histochemistry in invasive breast cancer [8].
Heparanase is an endo-β-glucuronidase that cleaves
heparan sulfate (HS) side chains of heparin sulfate pro-
teoglycan (HSPG). Heparanase activity has been correlated
with cell invasion associated with breast cancer metastasis, a
consequence of structural modification of HS that alters the
extracellular matrix [9, 10]. However, classical mammalian
heparanase is an intracellular enzyme and is not specific
to metastatic sites [11–13]. Therefore, another source of
heparanase may come from chemokines which are secreted.
Chemokines are a family of small molecular weight
proteins. CXCL7 is a member of the CXC subfamily of
chemokines which can be further subdivided on the basis
of the presence of the tripeptide motif glutamate-leucine-
arginine (ELR). All ELR
+
-CXC chemokines act through CXC
chemokine receptor type1 or type2 (CXCR1 and CXCR2)
[14]. CXCL7, has dual functions of heparin binding and is
a ligand to the G-protein linked receptor CXCR2 [15].

2 Journal of Oncology
Until recently, CXCL7 gene expression was thought to
be restricted to cells within the megakaryocytic lineage
[16, 17], as well as to neutrophils and lymphocytes. Recent
reports have suggested that other cell types may produce
this chemokine as well [18–23]. Despite studies on increased
expression of CXCR2 in breast cancer, reports on CXCL7 in
breast cancer are limited.
Earlier studies from our laboratory have shown that
the malignant breast cancer cells express more CXCL7 than
premalignant MCF10AT cells. CXCL7-transfected MCF10AT
breast cells have much higher heparanase activity than
premalignant MCF10AT cells. CXCL7-transfected MCF10AT
cells are as invasive as malignant breast cancer cells [24]. In
addition, the expression of VEGF C and D is increased in
these transfectants [5].
Heparanase and the lymphangiogenesis factors VEGF-C
and VEGF-D are two important markers closely related to
the metastasic capabilty of breast cancer. In this paper, we
hypothesize that CXCL7 increases the expression of VEGF-
C, VEGF-D, and heparanase, and increases cell invasion via
CXCR2 signaling, all linked to tumor lymphangiogenesis and
metastasis.
2. Methods
2.1. Cell Culture and Plasmid Stable Transfection. The
MCF10AT cells [25] were cultured in Dulbecco’s Modified
Eagle’s Medium (DMEM)/F 12 (1 : 1) containing 5% horse
serum, supplemented with 10 µg/ml bovine insulin, EGF
(20 ng/ml), hydrocortisone (0.5 µg/ml), and cholera toxin
(100 ng/ml). Cells were cultured at 37
◦
Cina5%CO
2
atmosphere. All cell culture reagents were obtained from
Gibco (Grand Island, NY). Approximately, 1× 10
6
cells/well
were plated in 6-well plates in medium containing 5%
horse serum to grow overnight to 60%–70% confluency.
Transfection of the plasmid was performed by using Lipo-
fectamine 2000 (Invitrogen, USA). The cells were divided
into blank control group, negative control group, and the test
group. Only Lipofectamine 2000 was used for transfection
in the blank control group. Plasmid
P
EGFP -N1 was used
for transfection in the negative control group. Plasmid
P
EGFP -N1-CXCL7 was used for transfection in the test
group. The cells were transfected with the mixture of plasmid
and Lipofectamine 2000 (1: 3) in 2 ml serum-free medium.
At 24 hours after transfection, the medium was replaced
by normal medium containing 5% FBS and antibiotics up
to 72 hours post-transfection. Since the MCF10AT cells
were transfected cells, G418 could not be used for the
selection of the stably transfected cell line. Therefore, we
submitted the cells for the flow cytometry sorting by using
the EGFP antibody. The transfected cells were picked out for
subculture. For sh-RNA plasmid transfection we used the
same method the described above. The sh-PPBP plasmids
were purchased from ORIGENE (Rockville, MD).
2.2. In Vitro Invasion Assays. Briefly, BioCoat Matrigel
invasion chambers (Becton-Dickinson, Bedford, MA) were
rehydrated according to the manufacturer’s instructions. Cell
suspensions (2.5 × 10
5
cellsper2mlserum-freemedium)
were added to the top chamber, and complete medium in the
lower chamber. For control, inserts without Matrigel were
used. The cells were allowed to invade the Matrigel at 37
◦
C
in 5% CO
2
for 48 hours. The noninvading cells on the upper
surface of membrane were removed from the chamber by
gentle scrubbing with a cotton swab, and the invading cells
on the lower surface of the membrane were stained with the
Quick-Diff stain kit (Becton-Dickinson). After two washes
with water, the chambers were allowed to air dry. Membranes
were mounted on glass slides and counted manually under
a light microscope. Cells were counted in five high power
fields (40x magnification). The number of invading cells was
expressed as a percentage by the following: the mean number
of the cells invading through the Matrigel insert membrane
divided by the mean number of cells migrating under control
insert membrane conditions multiplied by 100. All assays
were performed in triplicate.
2.3. Quantitative Real-Time PCR. RNA was extracted using
the RNeasy Mini Kit (catalog no. 74,804; Qiagen, Valencia,
CA), including treatment with DNase I to prevent genomic
DNA contamination using RURBO DNA-free Kit (catalog
no. AM1907; Ambion, Foster City, CA) according to the
manufacturer’s instructions. Total RNA (two micrograms)
was reverse-transcribed to cDNA by using the SuperScript
III First-Strand Synthesis System (catalog no. 18080-051;
Invitrogen, Carlsbad, CA), according to the manufacturer’s
protocol. Three replicate samples were used for the three
cell lines. The primer sequences used for the reactions
are in Tab l e 1 along with expected products and GenBank
accession numbers. The thermocycler parameters were as
follows: an initial step at 95
◦
Cfor10min.,40cyclesof95
◦
C
for 20 sec., 58
◦
C for 30 sec., and 72
◦
C for 20 seconds. The
cycle threshold values were used to calculate the normalized
expression of VEGFC/D against β-actin. qRT-PCR was
performed in ABI 7500 Sequence Detection System using a
SYBR Green detection system (catalog no. 170- 8880; Bio-
Rad Laboratories). By identifying the threshold cycle (C
T
)for
expression of mRNA, the ∆C
T
for VEGF-C/D was calculated
and compared to vector transfected control cells; CXCL7
transfected cells and SB225002-treated CXCL7 transfected
cells. The ∆C
T
was converted into a ratio (target A/target B =
2
−∆CT
) describing the comparison of the relative expression
of VEGF-C/D (target A) to β-actin (target B) for each of
the lines. The Delta-delta model was used for comparison of
relative expression RT-PCR results for VEGF-C/D.
2.4. Protein Quantification. VEGF-C and VEGF-D protein
concentrations in conditioned media were measured by
enzyme-linked immunosorbent assay (ELISA) using human
VEGF-C or VEGF-D ELISA Development System (catalog
no. DVEC 00 and DVED00, R&D Systems, Minneapolis,
MN). Measurements were done at least in duplicate for 2
dilutions. The optical density at 570 nm and 450 nm was
determined for each well using the plate reader. Then the
reading at 570 nm was subtracted from the reading at 450 nm
for each well.

Journal of Oncology 3
Table 1: Summary of primers for Real-Time PCR.
Gene: VEGF-C
GenBank Accession No.: NM 005429
Product size: 128 bp
Primers:
Forward: 5
′
-GCCACGGCTTATGCAAGCAAAGAT-3
′
Reverse: 5
′
-AGTTGAGGTTGGCCTGTTCTCTGT -3
′
Gene: VEGF-D
GenBank Accession No.: NM 004469
Product size: 132 bp
Primers:
Forward: 5
′
-CGATGTGGTGGCTGTTGCAATGAA -3
′
Reverse: 5
′
-GCTGTTGGCAAGCACTTACAACCT -3
′
Gene: beta-actin
GenBank Accession No.: X00351
Product size: 125 bp
Primers:
Forward: 5
′
-GGACTTCGAGCAAGAGATGG-3
′
Reverse: 5
′
- AGCACTGTGTTGGCGTACAG -3
′
2.5. Heparanase Activity Measurement. The protein concen-
tration of the serum-free conditioned medium was measured
by the Bradford assay (BioRad, Richmond, CA, USA). The
heparanase activity of the conditioned medium was assessed
as heparan sulfate degrading enzyme activity using the
Heparan Degrading Enzyme Assay Kit (catalog no. MK412,
Takara, Ootsu, Japan). The duration of a series of assays was
100 min., including 45 min. of enzyme degradation reaction.
One unit of heparanase activity defined the activity which
degraded 0.063 ng of biotinylated heparin sulfate in 1 min.
at 37
◦
C and pH 5.8. The detection limit of this assay was
0.1 U/mL. Each value of heparanase activity was normalized
by protein concentration (U/g protein).
2.6. Western Blotting. Cells were processed for protein
extraction and western blotting using standard procedures.
Briefly, the cells were harvested in PBS, counted, and
lysed in the RIPA buffer (catalog no. R0278, SIGMA, St.
Louis, MO) with protease inhibitor cocktail (catalog no.
P8340, SIGMA, St. Louis, MO), and samples were kept at
4
◦
C. Protein concentration was determined for all samples
using the Bio-Rad protein assay (catalog no. 500-0006, Bio-
Rad, Richmond, CA). The equal-volume samples (50 µg)
were separated by SDS-PAGE on a 10% polyacrylamide
gel and transferred onto nitrocellulose membrane (catalog
no. 162-0114, Bio-Rad, Richmond, CA) using transfer tank.
Immunodetection was performed using pERK1/2 (catalog
no. 9101, Cell Signaling Technology) and ERK1/2 (catalog
no.9102, Cell Signaling Technology), then developed by ECL
(catalog no. PRN 2106, GE Healthcare, Waukesha, WI) and
was photodocumented.
2.7. Statistical Analysis. Results are expressed as mean ±
standard error of the mean (SEM), unless indicated other-
wise. For statistical analysis, one-way ANOVA was used, and
significance was defined as P<.05. Graphs were generated
using GraphPad Prism (GraphPad Software, San Diego, CA).
3. Results
3.1. CXCR2 Antagonist SB225002 Reduced Invasion of
Matrigel by Stably CXCL7-Transfected MCF10AT Cells. To
further verify CXCL7 function in cell invasion, a selective
nonpeptide CXCR2 antagonist SB225002 [26]wasused
to check whether it can inhibit the invasive ability of
MCF10AT cells transfected with CXCL7. MCF10AT cells
were stably transfected with CXCL7 plasmid. After 48 hours
of incubation, cells were added into the Matrigel invasion
chamber; meanwhile, SB225002 (1.1 µM) was also added
into the chamber. Several concentrations of SB225002 were
tested (0.5, 0.7, 0.9, 1.1, 1.3, and 1.5 µM) and 1.1 µM had the
best inhibitory effect similar to that reported by Levashove
et al. [23]. After 48 hours, cells were fixed and stained
with Diff-Quick. The decrease in the percent invasion of
Matrigel by the cells is shown in Figure 1 .Treatmentwith
SB225002 resulted in 18.06%±0.76% invasive cells compared
with 55.7% ± 1.4% in nontreated CXCL7 stable transfected
MCF10AT cells. Thus, the CXCR2 antagonist blocked the
invasive ability of CXCL7 stably transfected MCF10AT cells.
3.2. Expression and Secretion of Lymphangiogenesis Fac-
tor VEGF-C and VEGF-D by Stable CXCL7 Transfected
MCF10AT Cells Are Blocked by SB225002. To investigate the
effect of SB225002 on expression and secretion of VEGF-C
and VEGF-D by stable CXCL7-transfected MCF10AT cells,
we cultured the cells with and without SB225002 (1.1 µM).
After 48-hour treatment, the media and the cells were
collected. Expression of mRNA for lymphangiogenic factors
VEGF-C and VEGF-D was determined by quantitative
real-time polymerase chain reaction (qRT-PCR) assay. The
expression levels of mRNAs for VEGF-C, VEGF-D, are
shown in Figure 2(a). β-actin was used as an internal control.
Compared with vector-transfected MCF10AT cells, CXCL7-
transfected MCF10AT cells showed 11-fold higher VEGF-
C and 18-fold higher VEGF-D expression. Administration
of SB225002 antagonist resulted in a significant (P<
.01) inhibition of VEGF-C (3.5-fold) and VEGF-D (3-fold)
mRNA expression. Next, we examined the secretion of the
VEGF-C and VEGF-D by ELISA assay. The secretion levels
of VEGF-C, VEGF-D are shown in Figure 2(b).BothVEGF-
C and VEGF-D secretion from the CXCL7-transfected cells
were significantly (P<.01) increased compared with the
vector-transfected control group (VEGF-C, 3-fold; VEFG-
D, 2.5-fold). Our data also showed a significant (P<.05)
inhibition in VEGF-C and VEGF-D secretion by SB225002-
treated cells compared with control treated cells. Thus the
CXCR2 antagonist decreases VEGF-C and VEGF-D mRNA
and protein expression.
3.3. CXCL7 siRNA Inhibited Heparanase Activity and Inva-
sion of CXCL7 Stably Transfected Cells. Next, we examined
whether CXCL7 siRNA inhibited the elevated heparanase

4 Journal of Oncology
0
10
20
30
40
50
60
70
I
n
v
a
s
i
o
n
c
e
l
l
s
(
%
)
CXCL7 stable transfected
Vector transfected control
SB225002
−
+
−
−
−
+
+
−
+
∗
Figure 1: CXCR2 antagonist SB225005 reduced the invasion of MCF10AT stably transfected with CXCL7 using a BD BioCoat Matrigel
invasion assay (6-well plates), 1.25 x 10
5
cells/ml were inoculated onto the membrane in serum-free medium. For the blocking experiment,
there was serum-free medium containing SB225002 (1.1 µM) in the upper chamber. The lower chamber contained complete medium, and
the control membrane did not have Matrigel by which to measure the migration of cells. After 48 hours, membranes were fixed, stained, and
photographed, then the percent invasion was determined. Triplicate assays were done. Results are reported per cell line as percent invasion
± (mean number of cells invading Matrigel membrane/mean number of cells migrating through control membrane) ×100 (P<.01).
(Upper) SB225002 significantly decreased the invasion of CXCL7-stable transfected MCF10AT cells compared with notreated cells. (Lower)
Membranes were stained by Diff-Quik kit and were photographed (original magnification x 20).
activity of CXCL7-stably transfected cells. Cells were trans-
fected with CXCL7 siRNA or control siRNA, and after
48 hours, the CM was collected. Compared with control
siRNA treatment, CXCL7 siRNA-transfected cells showed
significant (P<.01) inhibition of heparanase enzymatic
activity (Figure 3(a)). The same results were obtained after
using a Microcon filter to remove molecules less than 30 kD
(which includes CXCL7) from CM, verifying by ELISA that
CXCL7 is not present after filtering. And then, retesting for
heparanase activity were performed.
To further confirm the increased invasion after trans-
fection by CXCL7, we used the CXCL7 siRNA to block
the CXCL7 signal. Matrigel invasion assays were performed
with cells transfected with CXCL7 siRNA or control siRNA.
The decrease in the percent invasion of Matrigel by the
cells is shown in Figure 3(b). Treatment with siRNA resulted
in 16% ± 1.2% invasive cells compared with 37% ± 2.5%
by MCF10AT cells transfected with CXCL7. Thus, CXCL7
siRNA inhibits the invasion of MCF10AT cells transfected
with CXCL7.
3.4. Expression and Secretion of Lymphangiogenesis Fac-
tor VEGF-C and VEGF-D by Stable CXCL7 Transfected
MCF10AT Cells Are Silenced by sh-PPBP Transfection. To
further confirm the increased expression and secretion of
lymphangiogenesis factors VEGF-C and VEGF-D after trans-
fection by CXCL7, we used the sh-PPBP to silence the CXCL7
signal. To investigate the effect of sh-PPBP on expression and
secretion of VEGF-C, VEGF-D of stable CXCL7-transfected
MCF10AT cells, we cultured the cells transfected with sh-
PPBP or control (sh-con). After 48 hours of transfection,
the media and the cells were collected. Expression of the
mRNA of lymphangiogenic factors VEGF-C and VEGF-D
was determined by quantitative real-time polymerase chain
reaction (qRT-PCR) assay. The expression levels of mRNAs
for VEGF-C, VEGF-D, are shown in Figure 4(a). β-actin
was used as an internal control. Compared with vector-
transfected MCF10AT cells, CXCL7-transfected MCF10AT
cells showed 11-fold higher VEGF-C and 18-fold higher
VEGF-D expression. The sh-PPBP transfection resulted in a
significant (P<.01) silencing of VEGF-C (66%) and VEGF-
D (68%) mRNA expression. Next, we examined the secretion
of the VEGF-C and VEGF-D by ELISA assay. The secretion
levels of VEGF-C, VEGF-D are shown in Figure 4(b).Both
VEGF-C and VEGF-D secretion from the CXCL7-transfected
cells were significantly (P<.01) increased compared with the
vector-transfected control group (VEGF-C, 3.3-fold; VEFG-
D, 4.4-fold). Our data also showed a significant (P<.05)
silencing in VEGF-C (65%) and VEGF-D (68%) secretion by
sh-PPBP transfected cells compared with sh-con transfected
cells.
3.5. ERK1/2 Mitogen-Activated Protein Kinase Pathway Is
not Involved in CXCL7-CXCR2-Mediated Stimulation of
Lymphangiogenic Factors VEGF-C, VEGF-D in Human Breast
Cancer Cells. The MAP kinase pathway is important for
growth, differentiation, and migration, and is considered
a dominant signaling pathway for CXCR2 [27, 28]. To
investigate the mechanism by which the CXCL7-CXCR2
axis is involved in the stimulation of lymphangiogenic
factors VEGF-C, VEGF-D toward invasion by human breast
cancer cells, we investigated the involvement of ERK1/2

Journal of Oncology 5
0
2
4
6
8
10
12
F
o
l
d
s
∗
VEGF-C mRNA
0
4
8
12
16
20
∗
VEGF-D mRNA
(a)
0
10
20
30
40
50
60
70
P
r
o
t
e
i
n
c
o
n
c
e
n
t
r
a
t
i
o
n
(
p
g
/
m
L
)
CXCL7 stable transfected
Ve c to r
SB225002
−
+
−
+
−
+
−
−
+
∗
∗
0
20
40
60
80
100
120
140
−
+
−
+
−
+
−
−
+
VEGF-C protein VEGF-D protein
(b)
Figure 2: SB225005 blocked VEGF-C and VEG-D mRNA expression by CXCL7-transfected MCF10AT cells. CXCL7-stably transfected
MCF10AT cells were cultured with and without SB225002 (1.1 µM). After 48-hour treatment, the media and the cells were collected. (a)
Quantitative analysis of VEGF-C and VEGF-D mRNA expression. Total RNA was extracted, and real-time qRT-PCR was performed. β-actin
was applied as internal control. Triplicate determinations were performed. The differences between the cell lines were significant (P<.01).
(b) Quantitative analysis of VEGF-C and VEGF-D protein secretion by the CXCL7-stable transfected MCF10AT cells. Protein concentration
in CM was measured by ELISA using human VEGF-C and VEGF-D ELISA Development System. Measurements were done at least in
duplicate for 2 dilutions. The optical density of each well was determined using plate reader by subtracting the reading at 570 nm from the
reading at 450 nm. VEGF-C/D content in CM of SB225002-treated group was significantly lower than untreated group (P<.05).
MAP kinases by western blotting. Stable CXCL7-transfected
MCF10AT cells did not induce ERK1/2 phosphorylation in
comparison with the vector transfected control cells, and
there is no difference in ERK1/ 2 MAP kinase expression in
stable CXCL7 transfected MCF10AT cells compared to vector
controls (Figure 5).
4. Discussion
Although many molecules have been implicated in cancer
metastasis, the detailed mechanism of tumor metastasis is
still not completely understood. Recently, the interest in
chemokines in cancer research has been increasing as new
chemokines are being identified and investigated. Working
along with many other molecules, the chemokines and
their receptors expressed by both the cancer and its stroma
influence growth, dormancy, angiogenesis, and invasion [3,
6, 29]. The CXCR4/CXCL12 (SDF-1) axis was the most
common interaction that has been shown to be involved in
many different human malignancies, including breast cancer,
ovarian cancer, and prostate cancer [30, 31]. However,
CXCR4 interactions alone did not completely explain the
pattern of metastasis of cancer.
There are 4 families of chemokines (C, CC, CXC,
and CX3C) based on the arrangement of cysteine residues
near the N terminus [32, 33]. The CXC group can be
further subdivided on the basis of presence of the tripeptide
motif glutamate-leucine-arginine (ELR) adjacent to the
CXC motif. All ELR
+
-CXC chemokines act through CXC
chemokine receptor type 1 or type 2 (CXCR1 or CXCR2),
which are transmembrane G-protein-coupled receptors [32].
ELR
+
-CXC chemokines can stimulate angiogenesis. Those
without the ELR motif inhibit angiogenesis [34, 35]. Secre-
tion of stromal cell-derived factor-1 (SDF-1)/CXCL12 and
expression of CXCR4 have been identified to be associated
with breast cancer metastasis [36]. Although CXCR4 was
more highly expressed in the breast cancer cells tested by

6 Journal of Oncology
0
0.1
0.2
0.3
0.4
H
e
p
a
n
a
r
a
s
e
a
c
t
i
v
i
t
y
(
u
/
m
L
)
∗
(a)
0
10
20
30
40
50
60
I
n
v
a
s
i
o
n
c
e
l
l
s
(
%
)
CXCL7 stable transfected
Vector transfected control
CXCL7 siRNA
Control siRNA
−
−
−
+
−
−
+
−
+
−
−
+
−
+
−
+
∗
(b)
Figure 3: CXCL7 siRNA decreased heparanase activity and invasion of CXCL7-stably transfected cells. The CXCL7 MISSION siRNA was
used to effectively knockdown heparanase activity and the invasion of CXCL7-stably transfected cells while the nontargeting siRNA was used
as a control. CXCL7-stable transfected MCF10AT cells (2× 10
5
) were transfected with 100 pmol of each siRNA by using the Lipofectamine
2000 transfection reagent (Invitrogen) after 48 hours in culture. (a) Quantifying heparanase activity. The CM was collected 24 hours later
and analyzed by heparanase-degrading enzyme assay kit. Indicated amounts of cell lysate were incubated with biotinylated heparan sulfate
at 37
◦
C for 45 minutes, and enzyme activity was determined using an ELISA-type assay. Color was developed using the substrate supplied in
the kit, and plates were read at 450 nm using a microplate reader. Decreased heparanase activity in CXCL7 siRNA. (b) Invasion of Matrigel.
Using a BD BioCoat Matrigel invasion assay (6-well plates), 1.25× 10
5
cells/ml were inoculated onto the membrane in the upper chamber in
serum-free medium. The lower chamber contained complete medium, and control membrane did not have Matrigel to measure migration
of cells. Triplicate assays per group were completed. Results reported per cell line as % invasion = (mean number of cells invading Matrigel
membrane/mean number of cells migrating through control membrane) ×100. CXCL7 siRNA significantly inhibited the invasion of CXCL7
stable transfected MCF10AT cell, while the control siRNA did not. Results compared by one-way ANOVA (P<.01).
Mu¨ller et al. [37] than the other CXCRs, the expression
of CXCR2 was also increased compared with the remain-
ing receptors. CXCL7, which is a member of the ELR-
CXC chemokines, binds with CXCR2 receptors, stimulating
angiogenesis and association with neutrophils and other
immune components [38]. Inhibition of CXCR2 function on
endothelial cells has been shown to inhibit tumor growth, for
lung cancer and renal cell cancer models [39, 40].
The use of a small selective antagonist for CXCR2
(SB225002) represents an attractive targeted therapeutic
approach [26]. Previous work in our laboratory showed that
breast cancer cells coexpress CXCL7 and CXCR2, which may
act as a potential autocrine mechanism in breast cancer.
The malignant cell line MCF10CA1a.cl1 strongly expressed
CXCL7 and has much higher invasive ability than MCF10AT.
MCF10AT cells gained invasive ability after they were trans-
fected with CXCL7. Thus, CXCL7-transfected MCF10AT
cells were as invasive as malignant cells, suggesting that
CXCL7 may have a role in the invasion process. Therefore,
targeting its receptor, CXCR2, seemed an obvious choice.
By using CXCL7-stably transfected MCF10AT cells
treated by SB225002, invasion was decreased significantly
compared with CXCL7-transfected cells, which might
involve CXCL7 autocrine activity with CXCR2. The present
study did not examine whether SB225002 could block the
invasive ability of isogenic malignant cells (MCF10CA1a.cl1)
or other malignant cell lines, which would be an interesting
focus for future study.
Lymphangiogenesis refers to the formation of new lym-
phatic vessels that may occur in normal developing tissues
or in tumors. Overexpression of VEGF-C or VEGF-D can
lead to lymphangiogenesis, intralymphatic tumor growth
and formation of lymph node metastases [41, 42]. VEGF-
C and VEGF-D are ligands for VEGFR-3 (also termed fms-
like tyrosine kinase 4, Flt-4), a tyrosine kinase receptor
that is expressed predominantly in lymphatic endothelial
cells [43]. The breast cancer cells secrete VEGF-C, VEGF-
D which directly interact with the receptor. This paracrine
relationship may lead to further changes in the breast
cancer cells leading to invasion. Chemokine and VEGF-C
interactions have been reported in a model of cross-talk
for lymphatic endothelial cells and melanoma cells [4]. In
our study, both the selective CXCR2 antagonist and sh-
PPBP suppresses the elevated expression and secretion of
VEGFC/D by the CXCL7-transfected MCF10AT cells. These
results support the notion that the CXCL7/CXCR2 axis plays
an important role in cancer cell lymphangiogenesis.
The chemokine connective tissue-activating peptide
(CTAP-III), which is an N-truncated derivative of CXCL7,
has been reported to have heparanase activity [15, 44].
The heparanase activity of chemokines may be important
for modification of matrix [15]. Heparanase activity is
also responsible for the egress of metastatic tumor cells
and other blood-borne cells from the vasculature. Inhibi-
tion of heparanase activity results in decreased metastasis.
Recently, expression of VEGF-C was shown to be induced

Journal of Oncology 7
0
2
4
6
8
10
12
14
F
o
l
d
s
∗
VEGF-C mRNA
0
5
10
15
20
∗
VEGF-D mRNA
(a)
0
20
40
60
C
o
n
c
e
n
t
r
a
t
i
o
n
(
p
g
/
m
L
)
CXCL7 stable transfected
Vector transfected control
sh-PPBP
sh-control −
−
+
−
−
−
−
+
−
+
−
+
+
−
−
+
∗
∗
0
20
40
60
80
100
−
−
+
−
−
−
−
+
−
+
−
+
+
−
−
+
Protein of VEGF-C Protein of VEGF-D
(b)
Figure 4: The sh-PPBP suppress VEGF-C and VEGF-D mRNA expression and secretion by CXCL7-transfected MCF10AT cells. We cultured
the cells transfected with sh-PPBP or control sh-con. After 48 hours treatment, the media and the cells were collected. (a) Quantitative
analysis of VEGF-C and VEGF-D mRNA expression. Total RNA was extracted, and real-time qRT-PCR was performed. β-actin was applied as
internal control. Triplicate determinations were performed. The differences between the cell lines were significant (P<.01). (b) Quantitative
analysis of VEGF-C and VEGF-D protein secretion by the CXCL7 stable transfected MCF10AT cells. Protein concentration in CM was
measured by ELISA using human VEGF-C and VEGF-D ELISA Development System. Measurements were done at least in duplicate for
2 dilutions. The optical density of each well was determined using plate reader by subtracting the reading at 570 nm from the reading at
450 nm. VEGF-C and VEGF-D content in CM of sh-PPBP-transfected group was significantly lower than the control group (P<.05).
by heparanase in prostate cancer cells, epidermoid can-
cer cells, breast cancer cells, and melanoma [6]. In this
study, heparanase activity in the CM of CXCL7-transfected
MCF10AT cells was tested, and it was determined that
the CXCL7-transfected cells demonstrated increased secreted
heparanase activity. This elevated activity was inhibited
by CXCL7 siRNA. In addition, silencing CXCL7 inhibited
the invasive ability of CXCL7-transfected MCF10 AT cells
which further elucidates its role in invasion. The expression
of VEGF-C and VEGF-D mRNA and protein was also
decreased in these transfectants by shRNA, thus linking
the expression of the chemokine CXCL7 to VEGF-C and
VEGF-D, heparanase expression, and invasive ability. The
MCF10 model of progressive breast disease provides isogenic
cell lines with increasing malignant potential to study the
steps of metastasis. Additional breast cancer cell lines and
breast cancer tissue can be tested specifically for CXCL7
expression and effects on lymphangiogenesis, heparanase
expression and invasion in the future. Lymphangiogenesis in
human breast cancer samples can be correlated with clinical
parameters and CXCL7/CXCR2 staining.
To explain the mechanism by which the CXCL7-
CXCR2 axis is involved in the stimulation of lymphan-
giogenic factors VEGF-C, VEGF-D, increased invasion and
heparanase expression in human breast cancer cells. We
investigated the MAP kinase signaling pathway [45, 46].
We demonstrated that CXCL7-stable transfected MCF10AT
cells do not activate ERK1/2 MAP kinase signaling. We
did not observe a difference of ERK1/2 kinase in CXCL7-
stable transfected MCF10AT cells compared with control
cells. This result suggests the involvement of different
pathways other than MAP kinase signaling for the CXCL7-
CXCR2 axis activation. In general, the activation of G-
protein coupled receptors (GPCRs) like CXCR2 leads to
the dissociation of the α subunit from the β,γ-dimer
when GDP is replaced by GTP [47]. Both subunits can
activate many signaling pathways including phospholipase C
and adenyl cyclase. When specifically considering CXCR2,
information from CXCL8 might shed some light on other
potential pathways for CXCL7 since these two chemokines
have 48% identity in their amino acid sequences and both
bind CXCR2 [48]. CXCL8 binding to CXCR2 activates

8 Journal of Oncology
M
C
F
1
0
A
T
/
v
e
c
t
o
r
M
C
F
1
0
A
T
/
v
e
c
t
o
r
M
C
F
1
0
A
T
/
C
X
C
L
7
M
C
F
1
0
A
T
/
C
X
C
L
7
P
o
s
i
t
i
v
e
c
o
n
t
r
o
l
pERK1/2
ERK1/2
Figure 5: ERK1/2 mitogen-activated protein kinase is not active
in CXCL7 stable transfected MCF10AT cells. Briefly, the cells were
harvested in PBS, counted and lysed in the RIPA buffer with
protease inhibitor cocktail. Protein concentration was determined
for all samples using the Bio-Rad protein assay. The equal-
volume samples (50 µg) were separated by SDS-PAGE on a 10%
polyacrylamide gel and transferred onto nitrocellulose membrane.
Immunodetection was performed using pERK1/2 and ERK1/2,
then developed by ECL. Stable CXCL7 transfected MCF10AT cells
did not induce ERK1/2 phosphorylation compared to the vector
transfected control cells. Furthermore, the expression of ERK1/2
was the same in stable CXCL7 transfected MCF10AT cells compared
to vector controls.
the Rac/PI3K, Rho and Ras pathways [49]. Therefore, the
CXCL7/CXCR2 axis may activate pathways other than the
MAP kinase pathway, including Rac/PI3K, Rho and Ras
pathways.
5. Conclusions
In the present paper we showed that both the selective
CXCR2 antagonist SB225002 and sh-PPBP suppress VEGF-
C, VEGF-D expression and secretion in CXCL7-transfected
MCF10AT cells. Furthermore, we also observed that both
SB225002 and CXCL7 siRNA reduced the invasion of
CXCL7-stably transfected MCF10AT cells, confirming the
role of the CXCL7/ CXCR2 axis in cell invasion, possibly
through the receptor’s signaling mechanism. However,
this does not involve the MAP kinase signaling pathway as
has been described for other ELR
+
CXC chemokines like
IL-8. It has also been shown that CXCL7 siRNA knocked
down heparanase activity in transfected MCF10AT cells,
suggesting an important role for CXCL7 in heparanase
expression. Taken together, these data would support
that the CXCL7/CXCR2 axis may be important in breast
cancer metastasis. Therapeutics aimed at antagonizing CXC
chemokine action, including CXCL7, may be beneficial in
preventing invasion and thus the spread of breast cancer.
Acknowledgments
The authors thank Beverly Torok-Storb, M.D., Ph.D., at the
Fred Hutchinson Cancer Research Center, for the gift of
CXCL7pIRES-enhanced green fluorescence protein plasmid,
and Dr. Fred Miller for ongoing discussion about breast
cancer models. This paper was supported by funding from a
VA Merit Review grant (M. A. Kosir) and research funding
from the Office of Vice President of Research (OVPR) at
Wayne State University (M.A.Kosir).
References
[1] A. Jemal, R. Siegel, E. Ward et al., “Cancer statistics, 2008,” CA
Cancer Journal for Clinicians, vol. 58, no. 2, pp. 71–96, 2008.
[2] W. Wang, S. Goswami, K. Lapidus et al., “Identification and
testingofageneexpressionsignatureofinvasivecarcinoma
cells within primary mammary tumors,” Cancer Research, vol.
64, no. 23, pp. 8585–8594, 2004.
[3] W. Wang, J. B. Wyckoff, S. Goswami et al., “Coordinated reg-
ulation of pathways for enhanced cell motility and chemotaxis
is conserved in rat and mouse mammary tumors,” Cancer
Research, vol. 67, no. 8, pp. 3505–3511, 2007.
[4]A.Issa,T.X.Le,A.N.Shoushtari,J.D.Shields,andM.
A. Swartz, “Vascular endothelial growth factor-C and C-
C chemokine receptor 7 in tumor cell-lymphatic cross-talk
promoteinvasivephenotype,”Cancer Research, vol. 69, no. 1,
pp. 349–357, 2009.
[5] M.Yu,Z.Tang,S.Alousi,R.S.Berk,F.Miller,andM.A.Kosir,
“Expression patterns of lymphangiogenic and angiogenic
factors in a model of breast ductal carcinoma in situ,”
American Journal of Surgery, vol. 194, no. 5, pp. 594–599, 2007.
[6] V. Cohen-Kaplan, I. Naroditsky, A. Zetser, N. Ilan, I. Vlo-
davsky, and I. Doweck, “Heparanase induces VEGF C and
facilitates tumor lymphangiogenesis,” International Journal of
Cancer, vol. 123, no. 11, pp. 2566–2573, 2008.
[7] T. Julian, V. Fourchotte, S. Anderson, et al., “Predictive
factors that identify patients not requiring a sentinel node
biopsy: continued analysis of the NSABP B-32 sentinel node
trial. Poster 2003,” San Antonio Breast Cancer Symposium,
December 2006.
[8] Y. Nakamura, H. Yasuoka, M. Tsujimoto et al., “Flt-4-positive
vessel density correlates with vascular endothelial growth
factor-D expression, nodal status, and prognosis in breast
cancer,” Clinical Cancer Research, vol. 9, no. 14, pp. 5313–5317,
2003.
[9] E. Zcharia, S. Metzger, T. Chajek-Shaul et al., “Molecular
properties and involvement of heparanase in cancer pro-
gression and mammary gland morphogenesis,” Journal of
Mammary Gland Biology and Neoplasia, vol. 6, no. 3, pp. 311–
322, 2001.
[10] I. Vlodavsky and Y. Friedmann, “Molecular properties and
involvement of heparanase in cancer metastasis and angiogen-
esis,” Journal of Clinical Investigation, vol. 108, no. 3, pp. 341–
347, 2001.
[11] V. Vreys and G. David, “Mammalian heparanase: what is the
message?” Journal of Cellular and Molecular Medicine, vol. 11,
no. 3, pp. 427–452, 2007.
[12] O. Goldshmidt, E. Zcharia, R. Abramovitch et al., “Cell
surface expression and secretion of heparanase markedly
promote tumor angiogenesis and metastasis,” Proceedings of
the National Academy of Sciences of the United States of
America, vol. 99, no. 15, pp. 10031–10036, 2002.
[13] N. Komatsu, M. Waki, M. Sue et al., “Heparanase expression
in B16 melanoma cells and peripheral blood neutrophils
before and after extravasation detected by novel anti-mouse
heparanase monoclonal antibodies,” Journal of Immunological
Methods, vol. 331, no. 1-2, pp. 82–93, 2008.

Journal of Oncology 9
[14] A. Ludwig, F. Petersen, S. Zahn et al., “The CXC-chemokine
neutrophil-activating peptide-2 induces two distinct optima
of neutrophil chemotaxis by differential interaction with
interleukin- 8 receptors CXCR-1 and CXCR-2,” Blood, vol. 90,
no. 11, pp. 4588–4597, 1997.
[15] A. J. Hoogewerf, J. W. Leone, I. M. Reardon et al., “CXC
chemokines connective tissue activating peptide-III and neu-
trophil activating peptide-2 are heparin/heparan sulfate-
degrading enzymes,” Journal of Biological Chemistry, vol. 270,
no. 7, pp. 3268–3277, 1995.
[16] E. Brandt, A. Ludwig, F. Petersen, and H.-D. Flad, “Platelet-
derived CXC chemokines: old players in new games,” Immuno-
logical Reviews, vol. 177, pp. 204–216, 2000.
[17] C. Zhang, P. Gadue, E. Scott, M. Atchison, and M. Poncz,
“Activation of the megakaryocyte-specific gene protein (PBP)
by the Ets family factor PU.1,” Journal of Biological Chemistry,
vol. 272, no. 42, pp. 26236–26246, 1997.
[18] N. Hda, M. Haisa, A. Igarashi, D. Pencev, and G. R. Groten-
dorst, “Leukocyte-derived growth factor links the PDGF and
CXC chemokine families of peptides,” FASEB Journal, vol. 10,
no. 11, pp. 1336–1345, 1996.
[19] A. Walz and M. Baggiolini, “A novel cleavage product of β-
thromboglobulin formed in cultures of stimulated mononu-
clear cells activates human neutrophils,” Biochemical and
Biophysical Research Communications, vol. 159, no. 3, pp. 969–
975, 1989.
[20] A. Schaffner, C. C. King, D. Schaer, and D. G. Guiney,
“Induction and antimicrobial activity of platelet basic protein
derivatives in human monocytes,” Journal of Leukocyte Biology,
vol. 76, no. 5, pp. 1010–1018, 2004.
[21] A. El-Gedaily, G. Schoedon, M. Schneemann, and A.
Schaffner, “Constitutive and regulated expression of platelet
basic protein in human monocytes,” Journal of Leukocyte
Biology, vol. 75, no. 3, pp. 495–503, 2004.
[22] L. Kruidenier, T. T. Macdonald, J. E. Collins, S. L. F. Pender,
and I. R. Sanderson, “Myofibroblast matrix metalloproteinases
activate the neutrophil chemoattractant CXCL7 from intesti-
nal epithelial cells,” Gastroenterology, vol. 130, no. 1, pp. 127–
136, 2006.
[23] Z.B.Levashova,N.Sharma,O.A.Timofeeva,J.S.Dome,and
A. O. Perantoni, “ELR
+
-CXC chemokines and their receptors
in early metanephric development,” Journal of the American
Society of Nephrology, vol. 18, no. 8, pp. 2359–2370, 2007.
[24] Z.Tang,M.Yu,F.Miller,R.S.Berk,G.Tromp,andM.A.Kosir,
“Increased invasion through basement membrane by CXCL7-
transfected breast cells,” American Journal of Surgery, vol. 196,
no. 5, pp. 690–696, 2008.
[25] P.J.Dawson,S.R.Wolman,L.Tait,G.H.Heppner,andF.R.
Miller, “MCF10AT: a model for the evolution of cancer from
proliferate breast disease,” American Journal of Pathology, vol.
148, no. 1, pp. 313–319, 1996.
[26] J. R. White, J. M. Lee, P. R. Young et al., “Identification
of a potent, selective non-peptide CXCR2 antagonist that
inhibits interleukin-8-induced neutrophil migration,” Journal
of Biological Chemistry, vol. 273, no. 17, pp. 10095–10098,
1998.
[27] K. L. Dunn, P. S. Espino, B. Drobic, S. He, and J. R. Davie,
“The Ras-MAPK signal transduction pathway, cancer and
chromatin remodeling,” Biochemistry and Cell Biology, vol. 83,
no. 1, pp. 1–14, 2005.
[28] S. Yoon and R. Seger, “The extracellular signal-regulated
kinase: multiple substrates regulate diverse cellular functions,”
Growth Factors, vol. 24, no. 1, pp. 21–44, 2006.
[29] B. S. Yadav, S. C. Sharma, R. Singh, G. Singh, and V. Kumar,
“Postmastectomy radiation and survival in patients with
breast cancer,” Journal of Cancer Research and Therapeutics,
vol. 3, no. 4, pp. 218–224, 2007.
[30]A.Muler,B.Homey,H.Sotoetal.,“Involvementof
chemokine receptors in breast cancer metastasis,” Nature, vol.
410, no. 6824, pp. 50–56, 2001.
[31] A. Zlotnik, “Involvement of chemokine receptors in organ-
specific metastasis,” Contributions to Microbiology, vol. 13, pp.
191–199, 2006.
[32] T. Kakinuma and S. T. Hwang, “Chemokines, chemokine
receptors, and cancer metastasis,” Journal of Leukocyte Biology,
vol. 79, no. 4, pp. 639–651, 2006.
[33] D. Rossi and A. Zlotnik, “The biology of chemokines and their
receptors,” Annual Review of Immunology, vol. 18, pp. 217–
243, 2000.
[34] R. M. Strieter, P. J. Polverini, S. L. Kunkel et al., “The
functional role of the ELR motif in CXC chemokine-mediated
angiogenesis,” Journal of Biological Chemistry, vol. 270, no. 45,
pp. 27348–27357, 1995.
[35] B. J. Rollins, “Chemokines,” Blood, vol. 90, no. 3, pp. 909–928,
1997.
[36] A. Orimo, P. B. Gupta, D. C. Sgroi et al., “Stromal fibroblasts
present in invasive human breast carcinomas promote tumor
growth and angiogenesis through elevated SDF-1/CXCL12
secretion,” Cell, vol. 121, no. 3, pp. 335–348, 2005.
[37] A. Mu¨ller, B. Homey, H. Soto et al., “Involvement of
chemokine receptors in breast cancer metastasis,” Nature, vol.
410, no. 6824, pp. 50–56, 2001.
[38] P. von Hundelshausen, F. Petersen, and E. Brandt, “Platelet-
derived chemokines in vascular biology,” Thrombosis and
Haemostasis, vol. 97, no. 5, pp. 704–713, 2007.
[39] M.P.Keane,J.A.Belperio,Y.Y.Xue,M.D.Burdick,andR.
M. Strieter, “Depletion of CXCR2 inhibits tumor growth and
angiogenesis in a murine model of lung cancer,” Journal of
Immunology, vol. 172, no. 5, pp. 2853–2860, 2004.
[40] J. Mestas, M. D. Burdick, K. Reckamp, A. Pantuck, R. A.
Figlin, and R. M. Strieter, “The role of CXCR2/CXCR2 ligand
biological axis in renal cell carcinoma,” Journal of Immunology,
vol. 175, no. 8, pp. 5351–5357, 2005.
[41] M. Jeltsch, A. Kaipainen, V. Joukov et al., “Hyperplasia of
lymphatic vessels in VEGF-C transgenic mice,” Science, vol.
276, no. 5317, pp. 1423–1425, 1997.
[42] S. A. Stacker, C. Caesar, M. E. Baldwin et al., “VEGF-
D promotes the metastatic spread of tumor cells via the
lymphatics,” Nature Medicine, vol. 7, no. 2, pp. 186–191, 2001.
[43] A. Kaipainen, J. Korhonen, T. Mustonen et al., “Expression
of the fms-like tyrosine kinase 4 gene becomes restricted
to lymphatic endothelium during development,” Proceedings
of the National Academy of Sciences of the United States of
America, vol. 92, no. 8, pp. 3566–3570, 1995.
[44] M. Rechter, O. Lider, L. Cahalon et al., “A cellulose-binding
domain-fused recombinant human T cell connective tissue-
activating peptide-III manifests heparanase activity,” Biochem-
ical and Biophysical Research Communications, vol. 255, no. 3,
pp. 657–662, 1999.
[45] S. Singh, K. C. Nannuru, A. Sadanandam, M. L. Varney, and
R. K. Singh, “CXCR1 and CXCR2 enhances human melanoma
tumourigenesis, growth and invasion,” British Journal of
Cancer, vol. 100, no. 10, pp. 1638–1646, 2009.
[46] J. Heidemann, H. Ogawa, M. B. Dwinell et al., “Angiogenic
effects of interleukin 8 (CXCL8) in human intestinal microvas-
cular endothelial cells are mediated by CXCR2,” Journal of
Biological Chemistry, vol. 278, no. 10, pp. 8508–8515, 2003.

10 Journal of Oncology
[47] S. Singh, K. C. Nannuru, A. Sadanandam, et al., “CXCR1 and
CXCR2 enhances human melanoma, Premont RT, and
Lefkowitz RJ,” Nature Reviews Molecular Cell Biology, vol. 3,
pp. 639–650, 2002.
[48] K. J. Laing and C. J. Secombes, “Chemokines,” Developmental
and Comparative Immunology, vol. 28, no. 5, pp. 443–460,
2004.
[49] J. Gavard, X. Hou, Y. Qu et al., “A role for a CXCR2/phos-
phatidylinositol 3-kinase γ signaling axis in acute and chronic
vascular permeability,” Molecular and Cellular Biology, vol. 29,
no. 9, pp. 2469–2480, 2009.