Sign up & Download
Sign in

Generation, identification and functional characterization of the nob4 mutation of Grm6 in the mouse.

by Lawrence H Pinto, Martha H Vitaterna, Kazuhiro Shimomura, Sandra M Siepka, Victoria Balannik, Erin L McDearmon, Chiaki Omura, Stephen Lumayag, Brandon M Invergo, Brett Glawe, Donald R Cantrell, Samsoon Inayat, Marissa A Olvera, Kirstan A Vessey, Maureen A McCall, Dennis Maddox, Catherine W Morgans, Brandon Young, Mathew T Pletcher, Robert F Mullins, John B Troy, Joseph S Takahashi show all authors
Visual Neuroscience (2007)

Abstract

We performed genome-wide chemical mutagenesis of C57BL/6J mice using N-ethyl-N-nitrosourea (ENU). Electroretinographic screening of the third generation offspring revealed two G3 individuals from one G1 family with a normal a-wave but lacking the b-wave that we named nob4. The mutation was transmitted with a recessive mode of inheritance and mapped to chromosome 11 in a region containing the Grm6 gene, which encodes a metabotropic glutamate receptor protein, mGluR6. Sequencing confirmed a single nucleotide substitution from T to C in the Grm6 gene. The mutation is predicted to result in substitution of Pro for Ser at position 185 within the extracellular, ligand-binding domain and oocytes expressing the homologous mutation in mGluR6 did not display robust glutamate-induced currents. Retinal mRNA levels for Grm6 were not significantly reduced, but no immunoreactivity for mGluR6 protein was found. Histological and fundus evaluations of nob4 showed normal retinal morphology. In contrast, the mutation has severe consequences for visual function. In nob4 mice, fewer retinal ganglion cells (RGCs) responded to the onset (ON) of a bright full field stimulus. When ON responses could be evoked, their onset was significantly delayed. Visual acuity and contrast sensitivity, measured with optomotor responses, were reduced under both photopic and scotopic conditions. This mutant will be useful because its phenotype is similar to that of human patients with congenital stationary night blindness and will provide a tool for understanding retinal circuitry and the role of ganglion cell encoding of visual information.

Cite this document (BETA)

Available from Brandon Invergo's profile on Mendeley.
Page 1
hidden

Generation, identification and functional characterization of the nob4 mutation of Grm6 in the mouse.

Generation, identification and functional characterization
of the nob4 mutation of Grm6 in the mouse
LAWRENCE H. PINTO,1 MARTHA H. VITATERNA,1 KAZUHIRO SHIMOMURA,1
SANDRA M. SIEPKA,1 VICTORIA BALANNIK,1 ERIN L. MCDEARMON,1,4 CHIAKI OMURA,1
STEPHEN LUMAYAG,1 BRANDON M. INVERGO,1 BRETT GLAWE,1 DONALD R. CANTRELL,2
SAMSOON INAYAT,2, 10 MARISSA A. OLVERA,3 KIRSTAN A. VESSEY,5
MAUREEN A. McCALL,5,6 DENNIS MADDOX,7 CATHERINE W. MORGANS,8
BRANDON YOUNG,9 MATHEW T. PLETCHER,9 ROBERT F. MULLINS,3 JOHN B. TROY,2
and JOSEPH S. TAKAHASHI1,4
1Department of Neurobiology and Physiology and Center for Functional Genomics, Northwestern University, Evanston, Illinois
2Department of Biomedical Engineering, McCormick School of Engineering Northwestern University, Evanston, Illinois
3Department of Ophthalmology & Visual Sciences, University of Iowa, Iowa City, Iowa
4Howard Hughes Medical Institute, Northwestern University, Evanston, Illinois
5Department of Psychological and Brain Sciences, University of Louisville, Louisville, Kentucky
6Department of Ophthalmology & Visual Sciences, University of Louisville, Louisville, Kentucky
7The Jackson Laboratory, Bar Harbor, Maine
8Neurological Sciences Institute, Oregon Health and Science University, Beaverton, Oregon
9The Scripps Research Institute, Jupiter, Florida
10Department of Mechatronics and Control Engineering, University of Engineering and Technology, Lahore, Pakistan
(Received December 19, 2006; Accepted February 1, 2007!
Abstract
We performed genome-wide chemical mutagenesis of C57BL06J mice using N-ethyl-N-nitrosourea ~ENU!.
Electroretinographic screening of the third generation offspring revealed two G3 individuals from one G1 family
with a normal a-wave but lacking the b-wave that we named nob4. The mutation was transmitted with a recessive
mode of inheritance and mapped to chromosome 11 in a region containing the Grm6 gene, which encodes a
metabotropic glutamate receptor protein, mGluR6. Sequencing confirmed a single nucleotide substitution from T to
C in the Grm6 gene. The mutation is predicted to result in substitution of Pro for Ser at position 185 within the
extracellular, ligand-binding domain and oocytes expressing the homologous mutation in mGluR6 did not display
robust glutamate-induced currents. Retinal mRNA levels for Grm6 were not significantly reduced, but no
immunoreactivity for mGluR6 protein was found. Histological and fundus evaluations of nob4 showed normal
retinal morphology. In contrast, the mutation has severe consequences for visual function. In nob4 mice, fewer
retinal ganglion cells ~RGCs! responded to the onset ~ON! of a bright full field stimulus. When ON responses could
be evoked, their onset was significantly delayed. Visual acuity and contrast sensitivity, measured with optomotor
responses, were reduced under both photopic and scotopic conditions. This mutant will be useful because its
phenotype is similar to that of human patients with congenital stationary night blindness and will provide a tool for
understanding retinal circuitry and the role of ganglion cell encoding of visual information.
Keywords: Chemical mutagenesis, Forward genetics, Retina, Retinal ganglion cells, Depolarizing bipolar cells,
Congenital stationary night blindness, ON pathway, Molecular cloning, Positional cloning, Gene discovery, Rod
pathway, Visual acuity
Introduction
One of the most notable features of the visual system is the
division of signals into parallel pathways, initiated at the synapse
between photoreceptors and the second order bipolar cells. This
parallel organization is maintained through higher levels of the
retinorecipient nuclei of the brain. Ever since Kuffler’s ~1953!
description of ON- and OFF-center retinal ganglion cells ~RGCs!,
the physiological and biochemical mechanisms for the ON and
OFF parallel pathways have been under investigation. Of partic-
ular note was the discovery that a metabotropic glutamate receptor,
mGluR6 ~Masu et al., 1995!, was responsible for initiating the ON
pathway ~Slaughter & Miller, 1981!. Using an intracellular, second
messenger-mediated cascade, mGluR6 creates a sign-inverting
depolarization in ON bipolar cells from the hyperpolarization of
Address correspondence and reprint requests to: Lawrence H. Pinto,
Dept. Neurobiology & Physiology, 2205 Tech Dr., Northwestern Univer-
sity, Evanston, IL 60208, USA. E-mail: larry-pinto@northwestern.edu
Visual Neuroscience ~2007!, 24, 111–123. Printed in the USA.
Copyright © 2007 Cambridge University Press 0952-5238007 $25.00
DOI: 10.10170S0952523807070149
111
Page 2
hidden
illuminated photoreceptors. Elimination of the Grm6 gene encod-
ing this receptor, using gene targeting, results in an elimination of
RGC responses to onset of a bright stimulus ~ON responses!
~Masu et al., 1995; Renteria et al., 2006!.
Gene knockouts are useful in defining the functional role of a
particular protein in a given system. However, a genetic analysis of
a complex process, such as initiation of the mGluR6-mediated
cascade, can be better served by an allelic series of mutations that
permit a detailed dissection of the underlying biochemical mech-
anisms. To this end, we have performed a search for random,
chemically-induced mutations that affect the electroretinogram
~ERG! ~Pinto et al., 2004!. Our search has yielded several mutants
~Vitaterna et al., 2006!, and among them one showed a normal
a-wave but lacked the b-wave of the ERG. Further, the retina in
these mutants had normal morphology. Because this was the fourth
mouse mutation that produced this phenotype, we named this new
mutant nob4. Among the others are nob ~Pardue et al., 1998!, a
mutation in the nyx gene that encodes the nyctalopin protein and
nob2 ~Chang et al., 2006!, a mutation in the Cacna1f gene that
encodes the a1F subunit of the voltage dependent calcium channel,
responsible for glutamate release from photoreceptors.
Because we took a forward genetics approach, the nob4 gene’s
identity was unknown. Thus, a genetic approach was needed to
map the gene and to identify the underlying mutation. Our exper-
iments led to the identification of a point mutation in the coding
region of Grm6. The effects of the nob4 mutation on retinal
structure and function were consistent with results recently ob-
served in mGluR6 knockout mice. In both mice, retinal morphol-
ogy was normal, but the absence of mGluR6 expression produced
significant deficits in visually-evoked responses of RGCs. In ad-
dition, we characterized the visually-guided behavior of nob4 mice
and found severe deficits in spatial vision. Because nob4 results
from a point mutation in the ligand binding portion of the mGluR6
protein, this mouse model should be useful for understanding the
contribution of the ON pathway to visually-guided behaviors,
dissecting the retinal circuitry of the ON pathway, and defining
biochemical mechanisms of bipolar cell signal generation.
Material and methods
For all experiments described, mice were treated in accordance
with the animal care and use committees at each of the institutions
and in compliance with the American Physiological Society and
Society for Neuroscience statements for ethical care and use of
animals.
Mutagenesis and mouse production
Details of the mutagenesis and screening procedures have been
published previously ~Pinto et al., 2005!. Male C57BL06J mice
were mutagenized with three, weekly doses of N-ethyl-N-nitrosourea
~90–100 mg0kg body weight! starting at 6 weeks of age. ENU
treated males were bred with WT females to produce mutant
generation 1 ~G1! offspring, in which each mouse represents one
mutagenized gamete. G1 males and G1 females from different G0
founders were intercrossed with one another to produce G2 mice,
and G2 siblings were then intercrossed ~as breeding trios when
possible! to generate G3 offspring for phenotyping. Sufficient
breeding pairs were used to give a 80% probability of detecting
a recessive mutation in the kindred; six G2 intercrosses were
established for each kindred and at least six G3 pups tested per G2
mother ~Siepka & Takahashi, 2005!. All G3 mice were screened
for a number of neurobiological traits starting at 6 weeks of age
~Vitaterna et al., 2006! and were tested for the electroretinogram
starting at 12 weeks of age.
Electroretinogram
Scotopic ERGs were performed in total darkness with the aid of
infra-red image converters ~Rigel Optics! and infra-red safelamps
~Kodak, #11 filter! as described previously ~Pinto et al., 2005!.
Mice were dark-adapted for at least 2 h prior to recording. Anes-
thesia was induced with a mixture of ketamine ~70 mg0kg! and
xylazine ~7 mg0kg! administered intraperitoneally, and body tem-
perature was maintained between 36.58C to 378C. ERGs were
obtained by differential recording of the corneal voltages between
the two eyes with Dawson, Trick, and Litzkow ~DTL! silver0nylon
fiber electrodes ~Dawson et al., 1979!. The corneas were wetted
with a solution of 1.2% cellulose in 0.9% NaCl. Diffuse stimuli
were presented from LEDs to the right eye, which was covered
with a clear contact lens made from heat-molded plastic film
~Aclar!. The left eye was covered with an opaque contact lens.
Nine full-field flash stimuli ~luminance 7104 to 300 cd{s0m2!
were presented against a dark background for the scotopic ERG.
Subsequently, a steady, dim adapting light ~0.5 cd0m2! was pre-
sented steadily in order to saturate the rod contribution. The
adapting light was presented during the 15 sec interval when a
flash stimulus ~luminance 0.2 cd{s0m2! was applied repetitively in
order to evoke the photopic ERG. The ERG was recorded at 1kHz
with a resolution of 0.5 µV. Response averaging was employed for
the responses to dim stimuli to increase their signal-to-noise ratio.
Responses were filtered to remove oscillatory potentials that occur
at about the time of the peak of the b-wave of the electroretino-
gram. All stimulus presentation and data recording were controlled
by software that is available to the scientific community ~http:00
www.neuromice.org0browseAssays.do, or http:00www.genome.
northwestern.edu0neuro0vision_protocol.cfm!. Analysis of the
ERGs was done automatically using MATLAB analysis software
~the Mathworks, Inc.!. The peak amplitude of the a-, b-, and
c-waves of the ERG was assessed under scotopic and photopic
conditions. For very dim stimuli, the amplitude of the scotopic
threshold response ~STR!, which is an indicator of post-
photoreceptor, inner retinal activity ~Saszik et al., 2002! was also
assessed.
Fundus photography
The iris was dilated with 1% tropicamide ~Mydriacil!, the corneas
kept moist with saline solution, and body temperature maintained
between 36.58C to 378C during photography. Digital images were
made with a small animal fundus camera ~model KD-211C, Kowa,
Tokyo, Japan, 2.5 megapixels! equipped with a 66 diopter supple-
mental lens.
Genotyping
All of the genotyping was accomplished by use of a single-base
extension reaction using the Sequenom genotyping platform. This
is a two-step process. First, the region containing the SNP is
amplified. Then, a primer ending at the polymorphic site is used
for the single-base extension reaction. The products are then sorted
by matrix-assisted laser desorption ionization, time-of-flight mass
spectrometry ~MALDI-TOF MS!. Briefly, primers for PCR and
single base extension reactions were designed by using the
112 L.H. Pinto et al.
Page 3
hidden
MassARRAY Assay Design 3.0 software package ~Sequenom,
Inc., San Diego, CA!. One milliliter of 2.5–10ng0mL genomic
DNA was combined with 1.85 mL of water, 0.1mL of 25 mM
dNTPs ~Invitrogen Corp., Carlsbad, CA!, 0.1mL of 5 units0mL
HotStar Taq ~Qiagen Inc., Valencia CA!, 0.625 mL of 10 HotStar
PCR buffer containing 15 mM MgCl2, 1mL PCR primers mixed
together at a concentration of 500 nM for multiplexed reactions,
and 0.325 mL of 25 mM MgCl2. Reactions were heated at 958C for
15 min followed by 45 cycles at 958C for 20 s, 568C for 30 s, and
728C for 1 min and a final incubation at 728C for 3 min. After PCR
amplification, remaining dNTPs were dephosphorylated by adding
1.5 mL of water, 0.17 mL of 10 SAP buffer ~Sequenom, Inc., San
Diego, CA!, and 0.3 units of shrimp alkaline phosphatase ~Seque-
nom, Inc., San Diego, CA!. The reaction was placed at 378C for
20 min, and the enzyme was deactivated by incubating at 858C for
5 min. After shrimp alkaline phosphatase treatment, the genotyp-
ing reaction was combined with 0.76 mL of water, 0.2 mL of
iPLEX termination mix ~Sequenom, Inc., San Diego, CA!, 0.04
mL of iPLEX Enzyme ~Sequenom, Inc., San Diego, CA!, 0.2 mL
of 10 iPLEX Buffer, and 0.81mL of 7–14 mM multiplexed
extension primers. The MassEXTEND reaction was carried out at
948C for 2 min and then 99 cycles of 948C for 5 s, 528C for 5 s, and
728C for 5 s. The reaction mix was desalted by adding 3 mg of a
cationic resin, SpectroCLEAN ~Sequenom, Inc., San Diego, CA!,
and resuspended in 30 mL of water. Completed genotyping reac-
tions were spotted in nanoliter volumes onto a matrix arrayed into
384 elements on a silicon chip ~Sequenom SpectroCHIP!, and the
allele-specific mass of the extension products were determined by
MALDI-TOF MS. Analysis of data was accomplished using the
SPECTROTYPER software.
Initially, 8 mice ~6 mutant and 2 WT littermates! were typed
with a panel of 303 SNP assays evenly spaced across the genome.
A forty-Mb region on MMU11 showed a perfect phenotype-
genotype correlation. The eight original samples and an additional
31 were genotyped at a higher marker density in this region,
narrowing the candidate region to 28 Mb on MMU11, between 29
Mb and 57 Mb.
Grm6 messenger RNA abundance
Gene expression assays were performed as previously described
~Pinto et al., 2005!. Briefly, total RNA was extracted from mouse
retinas ~four retinas from 2 mice of each genotype! using Trizol
~Invitrogen, San Diego, CA!, according to manufacturer’s instruc-
tions. RNA concentration was measured by spectrophotometry and
samples were normalized by diluting in DEPC-treated sterile
water. TaqMan real-time ~quantitative! PCR assays were per-
formed using the comparative CT method, with an ABI 7700
Sequence Detector and TaqMan EZ RT-PCR kit reagents ~ABI,
Foster City, CA!. Control probe and primer sets have been de-
scribed previously ~Pinto et al., 2005!. The probe for Grm6
was 5'CCGCTTCAATGGTGACGCAGGAAC3' and the mGrm6
primers were F: 5 'CGGACCCTGCTGCACTACAT3 ' and R:
5'CCCCATTCTCATTGAACATCACT3'.
Immunohistochemistry and microscopy
Mouse retinal sections were prepared and stained as described
previously ~Morgans et al., 2005!. Antibodies were used at the
following concentrations: mGluR6 ~Morgans et al., 2006!, 1:100;
PKCa ~Sigma, St Louis, MO!, 1:5000. Appropriate secondary
antibodies were coupled to either CY3 ~Jackson Immunochemi-
cals, West Grove, PA! and diluted 1:500, or Alexa-488 ~Molecular
Probes, Eugene, OR! and diluted 1:1000. Images were acquired on
a Zeiss LSM 510 confocal microscope with a 6301.40 oil
immersion objective. All figures shown are projections of several
consecutive optical sections of 1-µm thickness each for a total
thickness of 3–5 mm. For figures, brightness and contrast of
images were optimized with Adobe Photoshop 7.0.
Molecular biology and in-vitro cRNA transcription
The rat cDNA of mGluR2 ~a gift of Dr. J.P. Pin! was cloned into
the pBlueScript SK vector, the cDNA of mGluR6 ~a gift of Dr. D.
Hampson! and the cDNA of Gao-1were cloned into the pGEM-HJ
vector, and the cDNAs of GIRK1 and GIRK2 were cloned into the
pBS-MXT vector ~gifts from Dr. N. Dascal!. Point mutations in
mGluR2 and mGluR6 were created by PCR using the QuikChange
method ~Stratagene, La Jolla, CA! and verified by double-strand
DNA sequencing. Numbering of amino acids starts from the first
methionine of the ORF. For expression in oocytes, plasmids were
linearized with NotI ~mGluR2, mGluR6 and Gao-1! or with SalI
~GIRK1 and GIRK2!. Capped cRNAwas transcribed in vitro using
T3 or T7 RNA polymerases as appropriate ~mMessage mMachine;
Ambion, Austin, Texas!.
Heterologous expression and electrophysiological
recordings
Stage V–VI Xenopus laevis oocytes were prepared as described
previously ~Shimbo et al., 1996!. Oocytes were either injected with
0.2 ng of GIRK1 and GIRK2 cRNAs and 10 ng of mGluR2 cRNA
or were injected with 0.2 ng of GIRK1 and GIRK2 cRNAs, 1ng of
Gao-1 and 10 ng of mGluR6 cRNAs at 50 nL0oocyte, and assayed
3 days later. Two electrode voltage clamp recordings were carried
out using TEV-200 ~Dagan, Minneapolis, MN! connected to DIGI-
DATA 1440A and pCLAMP10 ~Axon Instruments, Foster City,
CA!. Oocyte perfusion and agonist application have been de-
scribed previously ~Sharon et al., 1997!. Currents were recorded at
a holding potential of 80 mV. Recorded oocytes were homog-
enized in lysis buffer ~50 mM Tris-HCl pH 8.0, 150 mM NaCl, 1%
Triton X-100 in the presence of a cocktail of protease inhibitors
~Cómplete; Roche Diagnostics GmbH, Germany!!. Western blot
analysis was performed as described previously ~Stern-Bach et al.,
1994!. Primary antibodies anti-rat mGluR2 and anti-mGluR6 ~Ab-
cam, Cambridge, MA! were used at 1:500 dilution.
In vitro recordings of mouse retinal ganglion
cell responses
Mice were euthanized by cervical dislocation. Their eyes were
enucleated under dim red illumination and placed into a Petri dish
containing an artificial cerebrospinal fluid ~ACSF! with the fol-
lowing composition ~mM!: NaCl, 124; KCl, 2.5; CaCl2, 2; MgCl2,
2; NaH2PO4, 1.25; Glucose, 22; NaHCO3, 26; and HEPES 20
~pH 7.35–7.45!. Isolation of the retina was performed in ACSF
under infrared illumination using a microscope equipped with
infrared converters. The eyes were punctured at the ora serata with
a sharp blade, and this incision was extended around the full
circumference of the eye with a small pair of scissors. The anterior
portion of the eye, along with the lens and much of the vitreous,
was gently separated from the posterior portion of the eye, and the
remaining vitreous was removed with a pair of forceps. Beginning
at the periphery and moving toward the optic nerve, the sclera was
nob4 mutation of Grm6 in the mouse 113
Page 4
hidden
gently teased away from the retina. Finally, the optic nerve and the
attached sclera were cut from the retina to complete the dissection.
The retina, placed ganglion cell side up on a nitrocellulose filter
paper, was placed onto the microelectrode array ~Multichannel
Sysems Darmstadt, Germany! and secured with a small manipu-
lator. The array chamber ~0.5 mL! was placed in the preamplifier
on an inverted microscope stage. The retina was superfused with
oxygenated ~95% O2, 5% CO2! ACSF maintained at 348C with a
2 mL0min flow rate. The retina was allowed to stabilize for at least
one hour before recordings were begun. This entire procedure,
from animal sacrifice to superfusion with ACSF needed to be
performed in 15 to 20 min for reliable recordings to be made.
A uniform field was projected onto the retina through the
objective lens of the microscope using one of its light input ports.
The stimulus was generated on a Sony Multiscan 17 se monitor
running at a frame rate of 150 Hz and controlled by a video card
and software interface ~VSG, Cambridge Research Systems!. The
stimulus consisted of a 1s Light-ON period followed by a 1s
Light-OFF period whose luminance at the retina was 3 cd0m2
during the light-ON period.
Voltage signals from the microelectrodes were amplified by the
MCS preamplifier ~bandpass 1–5000 Hz! and recorded using
MCRack software. Noise did not exceed 620 µV. Signals were
high-pass filtered digitally at 25 Hz, and spikes were detected with
a51 µV threshold. Spike sorting was performed in Offline Sorter
~Plexon Inc.! using an automated 2D T-Distribution Expectation
Minimization algorithm. Spike timestamps were exported to MAT-
LAB where custom scripts were used for further data analysis.
Peristimulus time histograms ~PSTHs! and raster plots of in-
dividual units were generated. On visual inspection, units without
a visual response were identified and categorized as NONRESPON-
SIVE. Visually responsive units lacking clear peaks at either
stimulus onset ~ON! or offset ~OFF! portions of the stimulus were
categorized as OTHER. The remaining units were classified as
either ON, OFF, or ON-OFF based on the ratio of mean spike rates
during the ON portion ~RON! and OFF portions ~ROFF! of the full
field stimulus. Cells with RON0ROFF ratios 4 were classified as
ON cells, those with ratios0.25 were classified as OFF cells, and
the remaining were classified as ON-OFF cells ~Nirenberg &
Meister, 1997; Nirenberg et al., 2001!, but see Sagdullaev and
McCall ~2005!.
To provide a quantitative measure of the time-course of high
spike activity, histograms were generated by counting, for every
cell, the times of the PSTH bins with firing rates greater than one
standard deviation above the mean firing rate of the cell ~high
spike activity!. Additionally, to analyze the latency of the ON and
OFF responses, PSTHs were smoothed using a Gaussian kernel
~s  25 ms!, and the time to maximum peak was determined for
the ON and OFF segments of the light stimulus. For ON responses,
the latency measures the time from onset of the light stimulus, and,
for OFF responses, the latency measures time from offset of the
light stimulus
In vivo recordings of mouse RGC responses
RGCs were recorded from nob4 ~n 4! and WT mice ~n 6! aged
35–60 days. Surgical techniques, as well as visual stimulation and
recording protocols, have been published previously ~Sagdullaev
& McCall, 2005; Chang et al., 2006!. Anesthesia was induced, as
described earlier for the ERG assessments and the mouse was
mounted in a stereotaxic frame. A small craniotomy was per-
formed and the cortex was removed by vacuum suction to visual-
ize the optic nerve. Eyedrops ~1% mydriacyl, 2.5% phenylephrine
HCl! were used to dilate the pupil and to paralyze accommodation.
A tungsten electrode ~40–70 MV impedance! was inserted into the
optic nerve anterior to the chiasm and action potentials from
individual retinal ganglion cell ~RGC! axons were amplified and
digitized at 15 kHz. RGC responses were played in real time over
an audiomonitor and displayed on both an oscilloscope and a
computer monitor, and stored for offline analysis, using Spike2
software. The receptive field ~RF! of each isolated RGC was
mapped onto a tangent screen ~placed 25 cm from the nodal point
of the mouse’s eye!, using a handheld Pantoscope or flashlight.
The tangent screen was replaced with a computer display monitor
centered on the RF and located at the same distance. Computer
controlled visual stimuli were presented on the monitor using
Vision Works for Electrophysiology software. RGCs were adapted
to a full field luminance 75 cd0m2 for three minutes and then
stimulated with full field flashes for 5 s ON ~150 cd0m2! and 5 s
OFF ~0 cd0m2! for a total of 30 cycles.
Responses were collected and displayed as averaged PSTHs
~50 ms bin width! and individual raster plots. For analysis of
response characteristics, averaged PSTHs were smoothed over a
100 ms bin width to a raised cosine function and a significant
response was defined as a response to stimulus onset ~ON! or
offset ~OFF! whose peak was above the mean firing rate at 75
cd0m26 3 SEM. Peak firing rate and time to peak ~TTP! after the
stimulus onset also were determined from the smoothed PSTH.
Optomotor responses
Spatial acuity and contrast threshold of awake, unrestrained
mice were assessed under both scotopic and photopic conditions
using the OptoMotry device ~Cerebral Mechanics, Lethbridge,
AL!. Head movements in response to a rotating sinusoidally-
modulated grating were scored as previously described ~Pinto
et al., 2005! by an observer who was neither able to observe the
direction of movement of the stimuli nor aware of the genotype of
the mouse. The use of the simple staircase protocol allowed the
observer to focus attention to the movements of the mouse’s head
~McGill et al., 2004!. Behavioral measurements were made be-
tween 1300 h and 1600 h. In order to test at low light levels, large
neutral density filters were applied directly to the surfaces of the
liquid crystal displays. In order to view the mouse at low light
levels a camera that is sensitive to infrared illumination ~Fire-i
board camera, Unibrain, San Ramon, CA 94583! and two infrared
light emitting diodes ~940 nm! were used. Screen luminance was
measured with an International Light IL-1700 photometer.
Results
Electroretinographic identification of the nob4 mutation
We used the ERG to examine visual function in the G3 offspring
in pedigrees derived from mutation-bearing G1 mice generated in
an ENU mutagenesis program ~Pinto et al., 2004!. For one pedi-
gree we found that the ERGs of two siblings lacked a b-wave,
although the a-wave and their retinal fundi appeared normal ~Fig. 1
top row!. The traits of both of these founders were transmitted with
a recessive mode of inheritance and we generated G5 and G7
homozygous mutant mice for further studies. The scotopic thresh-
old response ~STR!, a biphasic potential reflecting inner retinal
activity ~Saszik et al., 2002! also was absent in the two G3 founder
mice and each of over 30 of their progeny that also lacked the
b-wave ~Fig. 1 second row!. The photopic ERG ~background
114 L.H. Pinto et al.
Page 5
hidden
luminance 0.5 cd0m2! also lacked a b-wave ~Fig. 1 third row! and
this absence made the a-wave appear larger compared to WT mice
~Fig. 1 third row!. The c-wave of nob4 mice did not appear to be
affected.
The fundoscopic appearance in nob4 mutant mice was normal
~data not shown!. We examined the retinal anatomy of nob4 retinas
with H and E staining and found a normal laminar structure
~Fig. 2!. Thus, the mutation appeared to affect only inner retinal
Fig. 1. A. Electroretinograms of wild-type ~WT! ~left! and nob4 mutant ~right! mice. The numbers between the traces give the energy
of the flash stimuli that were used. Upper traces show the rod ERG; the second row of traces shows the scotopic threshold response
~STR!, and the third row of traces shows the light-adapted ~0.5 cd0m2! ERG. The lower graphs plot the peak values ~mean 6 SEM;
6 mice of each genotype! for the dark adapted responses against stimulus energy. Note that the b-wave and STR of the ERG were absent
from the mutant ~upper and second rows! and that lack of b-wave from the light-adapted mutant ERG causes the a-wave to appear larger
~third row!.
nob4 mutation of Grm6 in the mouse 115
Page 6
hidden
function without grossly altering the retinal structure, and we
decided to identify the gene abnormality that was responsible for
this interesting phenotype.
Mapping and molecular cloning of the nob4 mutation
The ERG phenotype in both G3 founders was transmitted with a
recessive mode of inheritance. For further studies, G5 and G7
homozygous mutant mice were generated. To map the nob4 mu-
tation, nob4 mice on a C57BL06J ~B6! background were crossed
with WT DBA02J ~D2! or 129Sl0J ~129! mice to produce
~D2XB6!F1 or ~129XB6!F1 progeny. F1 mice were intercrossed
to produce ~D2B6F1XB6!F2 or ~129B6F1XB6!F2 mice. A total of
42 F2 mice were produced, phenotyped with the ERG, and geno-
typed. A nonrecombinant region was identified on chromosome 11
that contained a strong candidate gene for this phenotype, Grm6
~encoding the mGluR6 metabolic glutamate receptor protein!.
Consistent with the hypothesis that nob4 resulted from a mutation
in Grm6, mice with null alleles for Grm6 displayed a similar ERG
phenotype ~Masu et al., 1995!. Sequencing of the Grm6 gene
revealed a single base substitution ~T709C! in codon 185 in the
second exon, resulting in a predicted alteration from serine to
proline. This mutation should disturb the secondary structure of the
molecule in this domain and alter folding or function of the
receptor.
Grm6 mRNA expression in the retina
The levels of Grm6 mRNAwere measured in nob4 mutant retinas,
using quantitative RT-PCR. Although not significant ~p  0.19,
student t-test!, Grm6 mRNA expression in nob4 retinas was only
;60% of that in WT retinas. Consistent with our histological
results, no significant changes in the expression levels of other
retinal genes were observed in nob4 retina: rhodopsin, Rom1 and
Thy1 ~p  0.19, 0.19, and 0.25, respectively, student t-test!.
Immunohistochemical examination of nob4 mutant retinas
We examined the pattern of mGluR6 expression in retinal sections.
Fig. 2 compares the patterns of expression of the rod bipolar cell
marker, PKCa with mGluR6. Expression of mGluR6 could not be
found in the mutant retinas although robust staining was evident in
WT sections. In both nob4 and WT mice, PKCa label showed that
the dendrites, somata, and axon terminals of rod bipolar cells had
normal morphology and terminated in the correct retinal layers.
Expression of mutant mGluR protein in vitro
The finding of a mutation in the Grm6 gene that leads to a
predicted change from Ser to Pro in the mGluR6 receptor protein
suggests, but does not prove, that this mutation is responsible for
the observed phenotypes of the nob4 mutant. To test this possibil-
ity we compared the glutamate-induced responses of mGluR6
receptor bearing the same mutation that was found in nob4 mutant
mice with those of the appropriateWT receptors in vitro. Glutamate-
induced currents were evoked from oocytes expressing the WT rat
mGluR6 receptor, the Gao-1 protein, and GIRK1-GIRK2 hetero-
dimeric reporter ion channels ~Fig. 3B! ~Sharon et al., 1997!.
However, application of glutamate to oocytes expressing the
mGluR6-S185P mutant protein did not evoke detectable currents. In
order to test whether the substitution of proline at the location of
the mutation found in nob4 is also deleterious in another metab-
otropic glutamate receptor we made similar measurements with the
mGluR2 receptor. The domain structure of the mGluR2 receptor is
similar to that of the mGluR6 receptor and glutamate-induced
currents of oocytes expressing mGluR2 are large ~Sharon et al.,
1997!. The mGluR6-S185P mutation found in nob4 mutant mice
occurs in the middle position of a short conserved FXR sequence
found in the LB1 extracellular domain of the receptor ~Kunishima
et al., 2000!. The FXR domain is found across all reported families
of metabotropic glutamate receptors, and we thus constructed the
mGluR2-A181P mutation and expressed the mutant protein in
Xenopus oocytes. Application of glutamate to oocytes that ex-
pressed the WT mGluR2 receptor resulted in large, Ba~II!-
sensitive currents ~Fig. 3A!, but application of glutamate to oocytes
expressing the mGluR2-A181P mutant protein did not evoke de-
tectable currents. Western blotting of whole lysed oocytes with the
appropriate antibodies that recognize intracellular epitopes dem-
onstrated that both the WT and mutant mGluR2 and mGluR6
proteins were expressed in oocytes. It is possible either that these
mutant proteins did not enter the surface membrane of the oocytes
or that they entered the surface membrane but were not functional.
Fig. 2. Histological appearance of the nob4 retina compared with that of
the wild-type ~WT! retina ~upper! and immunofluorescent localization of
mGluR6 and PKCa in the nob4 and WT retina ~lower!. Mouse retina
sections labeled by immunofluorescence with antibodies against either
mGluR6 or PKCa revealed that the nob4 retina contains no mGluR6
immunoreactivity. Rod-BPCs of nob4 mutants have largely normal mor-
phology as indicated by the PKCa labeling, though the subcellular distri-
bution of PKCa appears somewhat altered. Scale bar represents 20 mm and
applies to all panels. Abbreviations are as follows: OS, outer segments; IS,
inner segments; ONL, outer nuclear layer; OPL, outer plexiform layer;
INL, inner nuclear layer; IPL, inner plexiform layer.
116 L.H. Pinto et al.
Page 7
hidden
Wedid not measure surface expression levels of mGluR2 ormGluR6
in oocytes and the present work thus cannot distinguish between
these possibilities. The immunohistochemical studies of mutant and
WT retinas failed to detect any mGluR6 protein in the mutant mice
~Fig. 2!, suggesting that the possibility that degradation of the mu-
tant receptor occurs in vivo also needs to be considered. These re-
sults suggest that the replacement of the second residue of the
conserved FXR sequence is capable of resulting in severe alter-
ations of the characteristics of the mGluR6 receptor and is thus the
probable cause of the observed retinal phenotypes.
Single unit responses from isolated retinas in vitro
The responses to full field stimulation of single spike-generating
units ~predominantly RGC but including a minority of spiking
amacrine cells! from the isolated retinas of nob4 mutants differed
greatly from those recorded from WT retinas in two major ways
~Fig. 4!. First, ON responsive units were rarely recorded in nob4
retinas. Second, the ON response in most nob4 ON-OFF respon-
sive units was delayed relative to stimulus onset. One such unit is
shown in Fig. 4A. Interestingly, there was considerable variability
in the onset of this delayed ON response ~Fig. 5!, suggesting that
its effect on visual behavior might be minimal. To obtain an
unbiased estimate of the relative contributions of ON and OFF
signals in WT and nob4 retinas, we plotted the summed high spike
activity ~ 1 SD over the mean value! as a function of time for all
nob4 and WT cells ~Fig. 5!. The resulting summed response shows
that nob4 retinas have no short latency ON response peak, a
hallmark of WT responses to light onset. Further, the delayed ON
response peak contributes minimally to the summed response.
Fig. 3. In vitro expression of mGluR6 and mGluR2 WT and mutant receptors in Xenopus oocytes. Oocytes also expressed GIRK1 and
GIRK2 ion channels as reporters of activation of the receptors and, in experiments with mGluR6, Gao-1was co-expressed. Large
inward currents flow through GIRK channels when the expressing cell is exposed to elevated K ~hK!, and activation of mGluR2 or
mGluR6 by glutamate increases the GIRK currents. A. Two-electrode voltage-clamp recording from oocytes expressing the ~i!mGluR6
wild type and ~ii! mGluR6-S185P mutant receptor. Bars above traces show solution applied. ~iii!. Western blot analysis on whole-cell
protein fractions ~obtained from 14 oocytes! was performed as described in Methods. B. Two-electrode voltage-clamp recording from
oocytes expressing the ~i! mGluR2 wild type and ~ii! mGluR2-A181P mutant receptor. Bars above traces show solution applied. ~iii!.
Western blot analysis on whole-cell protein fractions ~obtained from 10 oocytes! was performed as described in Methods. Note that
the mutant proteins were expressed in oocytes, but that application of the activator ~glutamate! did not result in an increase in current
through the GIRK reporter ion channel.
nob4 mutation of Grm6 in the mouse 117
Page 8
hidden
Single unit responses recorded in vivo from nob4 RGCs
Like the visual responses of RGCs recorded in vitro, nob4 RGCs
~n  24 cells; 4 mice! recorded in vivo displayed significant
abnormalities compared to WT cells ~n  35 cells; 6 mice!. We
Fig. 4. ~A! Representative spike raster plots and peristimulus time histo-
grams ~PSTH, binwidth 10 ms! of ON, OFF and ON-OFF cell re-
sponses recorded from in vitro WT and nob4 retinas. Note the delayed
ON response for the ON-OFF cell of the nob4 mouse. All responses
were evoked by a full field flash visual stimulus, whose timecourse ~1 s
light ON and 1 s light OFF! is shown at the base of the figure. ~B!
Percentages of cell classes for wild type and nob4 mutant mice, based
on recordings from 163 cells from two wild type retinas and 153 cells
from two nob4 mutant retinas.
Fig. 5. High spike activity time course histograms for WT and nob4 mutant
mice in vitro. Histograms of high spike activity as a function of stimulus
time were generated by counting, from every cell ~ON, OFF, ON-OFF,
Nonresponsive and Other!, the times at which the spike rate was greater
than one standard deviation above the mean spike rate of the cell. These
histograms measure the time-course of high spike activity within the
population of RGCs. The wild type histogram ~A! displays peaks during
both the ON and OFF portions of the light stimulus. The nob4 histogram
~B!, however, displays a peak during only the OFF portion of the stimulus.
The dispersion in the time of the delayed ON response is indicated by the
bracket shown in B, which spans the lower and upper quartiles of this
response. The inset shows for WT and nob4 the means and standard
deviations of the latency of the ON responses of ON-OFF cells.
118 L.H. Pinto et al.
Page 9
hidden
recorded many nob4 RGCs that were spontaneously active but not
visually responsive to our full-field stimulus ~12.5%; 3024!, whereas
none of our WT cells were unresponsive. All of our WT RGCs
could be classified as ON, OFF or ON-OFF based on the timing of
their response to a full-field stimulus onset or offset ~Figs. 6 and
7A! and all of the ON-OFF RGCs in WT and nob4 were classified
as OFF-center RGCs based on RF center stimulation, consistent
with our previous observations ~Sagdullaev & McCall, 2005;
Chang et al., 2006!. Consistent with the in vitro results presented
earlier, nob4 ON RGCs were rarely encountered in vivo ~17%;
4024; Fig. 7A!, whereas ON RGCs represented 62% of the WT
population ~22035!. This suggests a loss of ON RGCs in nob4
mice ~Fig.7A!. When a response to stimulus onset could be
identified in nob4 RGCs, their peak response was significantly
delayed compared to WT ~Fig. 7B! and the peak firing rates
~Fig. 7C! of these delayed nob4 responses were significantly
reduced compared to WT ~26.3  3.3 spikes0sec vs. 73.2  6.5
spikes0s; p 0.006!. Together these characterizations and those in
vitro indicate that the absence of signaling through the mGluR6
receptor results in a selective deficit in the ON pathway, a con-
clusion consistent with the results in the mGluR6 knockout mouse
~Renteria et al., 2006!.
Fig. 6. Raster plots and average post-stimulus time histograms of typical wild-type ~WT! and nob4 retinal ganglion cell ~RGC!
responses to full field stimuli recorded from mice in vivo. Individual RGC responses were isolated from the optic nerve of mice in vivo
and the receptive field location determined. RGCs were stimulated with a full field stimulus of 5 s light ON ~150 cd0m2! and 5 s light
OFF ~0 cd0m2!. Typical responses for single WT ~left panel! and nob4 ~right panel! RGCs are plotted as raster plots and average
post-stimulus time histograms ~50 ms bin width!. Based on their responses to full field stimuli, RGCs could be classified as ON- ~top!,
OFF- ~middle! or ON-OFF ~bottom!. In addition, a subset of the nob4 RGCs was unresponsive ~not shown!.
nob4 mutation of Grm6 in the mouse 119
Page 10
hidden
Visually-induced behavior of nob4 mutants
The visual acuity of adult WT mice, measured using the optomotor
response, is about 0.4 c0deg for photopic luminances and the peak
value of the contrast sensitivity function ~15–20! occurs at about
0.064 c0deg ~McGill et al., 2004!. We found that both of these
measures were severely reduced for nob4 mice over a range of
luminances from 105 to 58 cd0m2 ~Fig. 8; ANOVA, p  0.01;
n  6 WT, 5 nob4!. In fact, the entire spatial frequency tuning
curve, measured with six spatial frequencies spanning a range of
nearly one decade, was reduced for nob4 mice under both scotopic
and photopic conditions ~Fig. 9; ANOVA, p  0.01; n 4 WT, 5
nob4!. In contrast to the findings for WT mice, the spatial fre-
quency tuning curve for nob4 mutant mice did not display a clear
peak, consistent with the absence of receptive field center0
surround organization in ON-RGCs found in recordings in vivo
~Vessey et al., in preparation!. We also measured acuity and peak
contrast sensitivity at early postnatal ages ~Fig. 10! and found that
the behavioral deficits evident in the adult were not progressive in
nob4 mice. The deficits were apparent as early as we tested, within
a day after eye opening. In nob4 and WT mice, some maturational
improvement occurred ~Fig. 10; ANOVA p  0.01; n  6 WT, 5
nob4!, but neither acuity nor peak contrast sensitivity were ever
similar to WT ~Fig. 10; ANOVA p  0.01; n  6 WT, 5 nob4!.
Discussion
Our mapping and sequencing data suggest that the nob4 defect
results from a point mutation in the Grm6 gene that causes a Ser
to Pro substitution at residue 185 of mGluR6. Confirmation of this
causal relationship comes from a number of sources. First, the
absence of an ERG b-wave, when the a-wave is normal, is a
phenotype consistent with a defect in signal transmission between
the photoreceptors and ON bipolar cells. Second, there is a com-
plete correlation between this genotype and the ERG phenotype in
mapping crosses. Third, the retinas of nob4 mice do not express
mGluR6 protein and the functional deficit is restricted to signaling
through the ON pathway. Fourth, recapitulation of the mutation in
mGluR6 and the related rat mGluR2 receptor in vitro produces a
defective protein ~Fig. 3!. Finally, the phenotype is similar to that
described in the mGluR6 knockout mouse and in humans with
autosomal recessive congenital stationary night blindness ~arC-
SNB! resulting from a mutation in the GRM6 gene ~Dryja et al.,
2005; Zeitz et al., 2005; O’Connor et al., 2006!. Thus, the conclu-
sion that the identified mutation in Grm6 is responsible for the
observed nob4 visual phenotypes is well supported.
Defects in visual processing were found at three different levels
in nob4 mice under scotopic and photopic conditions: the depo-
larizing bipolar cell, the RGC, and behaviorally. Specifically, nob4
mice lack an ERG b-wave, whereas the a-wave is spared. This
implies that although the photoreceptors hyperpolarize in response
to a light stimulus, transmission to second order retinal neurons,
in particular the depolarizing ~rod and On cone! bipolar cells, is
compromised. The absence of the STR of nob4 ERGs suggests that
transmission also is reduced between bipolar cells and their post-
synaptic partners ~Saszik et al., 2002!.
The defects in the visual responses of nob4 RGCs support this
conclusion and demonstrate that the defect is specific to the ON
pathway. The majority of nob4 RGCs recorded both in vitro and in
vivo only respond to the offset of a light stimulus. In addition, there
is a concomitant increase in the percentage of RGCs with sponta-
neous but no visually-evoked activity in nob4 mice. When nob4
RGCs with a response to light onset were found, the responses
were abnormal. First, the ON response was significantly delayed,
relative to the stimulus onset and the timing of the onset of the
response was variable. Further, ON responses contributed little to
Fig. 7. The proportions, kinetics and amplitudes of retinal ganglion cell
~RGC! responses recorded from wildtype ~WT! and nob4 mice in vivo.
Individual RGC responses were isolated from the optic nerve of mice in
vivo and characterized based on their response to a full field stimulus of 5 s
light ON ~150 cd0m2! and 5 s light OFF ~0 cd0m2!. Cells could be
classified as ON ~n 22 WT, n 4 nob4!, OFF ~n 5 WT, n 9 nob4!,
ON-OFF ~n 8 WT, n 8 nob4! or unresponsive ~n 0 WT, n 3 nob4!.
~A! The proportion of each cell class recorded from WT and nob4 mice
presented as a percentage of the total cell number. ~B! The time to peak and
~C! the peak amplitude of the excitatory response of RGCs from WT and
nob4 mice plotted as a function of cell class, where ON was obtained from
the response of ON only RGCs; OFF was obtained from OFF-only RGCs;
ON-OFF ON and ON-OFF OFF were obtained from the ON and OFF
excitatory responses respectively, recorded from ON-OFF cells.
120 L.H. Pinto et al.
Page 11
hidden
the overall response of the retina, because their excitatory re-
sponses were very small. These observations also are consistent
with defects observed in RGCs in Grm6 null mice ~Renteria et al.,
2006! and with the absence of ON responses in both the superior
colliculus ~Masu et al., 1995! and visual cortex ~Renteria et al.,
2006! of Grm6 null mice. Thus, a point mutation in the Grm6 gene
is capable of disrupting gene function, similar to that produced by
a null allele. In contrast to the ON responses, the OFF responses of
nob4 RGCs appear unaffected, a result consistent with the conclu-
sion that the ON and OFF pathways are separate and that the OFF
pathway carries a delayed ON response, observed in ON-OFF
responsive single units.
It is interesting to note that, although the ON and OFF path-
ways are believed to be parallel and separate, our behavioral data
argue that normal function in both pathways are required to
interpret spatial patterns of light and dark that comprise our visual
environment. The absence of one pathway in nob4 mice results in
severe deficits in visual acuity and contrast sensitivity at both
photopic and scotopic conditions. This decrease in visual perfor-
mance is so pronounced that the spatial frequency tuning curves of
nob4 mice fail to display a clear peak. When visual behavior of
either nob ~Gregg et al., 2003! or Grm6 null ~Masu et al., 1995!
mutant mice were assayed, using a shuttle box avoidance task with
a full-field light stimulus as the cue, their learning curves were
similar to WT. However, when the luminance of this cue was
decreased performance in nob mice dropped quickly ~Gregg et al.,
2003!.
Similarly, our comprehensive assay of spatial vision clearly
shows that some vision is mediated through the OFF pathway in
nob4 mice. However, information only through this pathway is in-
sufficient for normal levels of pattern vision, whereas it is probably
sufficient for simple luminance detection.
Our data do not address why the mutation from Ser to Pro at
position 185 of Grm6 reduces expression of the mGluR6 protein to
undetectable levels. However, examination of the crystallographic
structure of the related rat mGluR1 protein ~Kunishima et al.,
2000! shows that the S185P mutation lies in a b sheet that adjoins
a helix containing a ligand-interactingAsp residue ~D191 of mGluR6!
and a b sheet containing a ligand-interacting Thr residue ~T171 of
mGluR6! ~Rosemond et al., 2004!. Perhaps substitution of the pro-
line residue in the mutant protein results in misfolding of the pro-
tein and degradation prior to insertion into the plasma membrane.
Mutations in the rat mGluR6 receptor and the related mGluR2
receptor produced in vitro resulted in a defective protein ~Fig. 3!.
The elucidation of mechanisms underlying important biologi-
cal processes is aided by the availability of two sets of mutations;
an allelic series of mutations that affect a given gene product
involved in the process as well as a series of mutations that affect
each of several gene products involved in the process. Thus,
studies of the mechanism and role of the ON pathway in the visual
system will be expedited by the availability of mutations that affect
various gene products in this pathway. Together with nob4 allele
~mGluR6-S185P!, mutations in nyctalopin ~nob mutation! ~Pardue
et al., 1998; Gregg et al., 2003!, a voltage-gated calcium channel
~Cacna1f gene, nob2 mutation! ~Chang et al., 2006! and the
knockout of mGluR6 ~Masu et al., 1995!, should be of great help
in the study of the function of the essential ON pathway. Mutant
mice can be obtained at cost by academic investigators at http:00
www.neuromice.org0.
Fig. 8. Comparison of visual acuity ~left! and peak contrast sensitivity ~right; measured at 0.064 c0deg! for WT and nob4 mutant mice
as a function of luminance. Both of these measures of visual function were made using optomotor responses and were decreased in
the mutant retinas for every value of luminance tested above 105 cd0m2, at which luminance the responses became unreliable.
Fig. 9. Comparison of the spatial frequency tuning curves of WT and nob4
mutant mice. Note that the contrast sensitivity function, measured under
both scotopic and photopic conditions, had a clear peak for the WT mice
but did not have a peak for the mutant mice and that the values for the
mutant mice were lower for all spatial frequencies.
nob4 mutation of Grm6 in the mouse 121
Page 12
hidden
Acknowledgments
Supported by NIH Cooperative Research Agreement U01MH61915, R01
EY06669 ~JBT!, R01 EY014701 and R01 EY012354 ~MAMc!. DRC was
supported by the National Defense Science and Engineering Graduate
Fellowship and SI was supported by the US Fulbright Program.
References
Chang, B., Heckenlively, J.R., Bayley, P.R., Brecha, N.C., Davisson,
M.T., Hawes, N.L., Hirano, A.A., Hurd, R.E., Ikeda, A., Johnson,
B.A., McCall, M.A., Morgans, C.W., Nusinowitz, S., Peachey,
N.S., Rice, D.S., Vessey, K.A. & Gregg, R.G. ~2006!. The nob2
mouse, a null mutation in Cacna1f: Anatomical and functional abnor-
malities in the outer retina and their consequences on ganglion cell
visual responses. Visual Neuroscience 23, 11–24.
Dawson, W.W., Trick, G.L. & Litzkow, C.A. ~1979!. Improved electrode
for electroretinography. Investigative Ophthalmology & Visual Science
18, 988–991.
Dryja, T.P., McGee, T.L., Berson, E.L., Fishman, G.A., Sandberg,
M.A.,Alexander, K.R., Derlacki, D.J. & Rajagopalan,A.S. ~2005!.
Night blindness and abnormal cone electroretinogram ON responses in
patients with mutations in the GRM6 gene encoding mGluR6. Pro-
ceedings of the National Academy of Science USA 102, 4884–4889.
Gregg, R.G., Mukhopadhyay, S., Candille, S.I., Ball, S.L., Pardue,
M.T., McCall, M.A. & Peachey, N.S. ~2003!. Identification of the
gene and the mutation responsible for the mouse nob phenotype.
Investigative Ophthalmology & Visual Science 44, 378–384.
Kuffler, S.W. ~1953!. Discharge patterns and functional organization of
mammalian retina. Journal of Neurophysiology 16, 37–68.
Kunishima, N., Shimada, Y., Tsuji, Y., Sato, T., Yamamoto, M., Ku-
masaka, T., Nakanishi, S., Jingami, H. & Morikawa, K. ~2000!.
Structural basis of glutamate recognition by a dimeric metabotropic
glutamate receptor. Nature 407, 971–977.
Masu, M., Iwakabe, H., Tagawa, Y., Miyoshi, T., Yamashita, M.,
Fukuda, Y., Sasaki, H., Hiroi, K., Nakamura, Y., Shigemoto, R.,
Takada, M., Nakamura, K., Nakao, K., Katsuki, M. & Nakanishi,
S. ~1995!. Specific deficit of the ON response in visual transmission by
targeted disruption of the mGluR6 gene. Cell 80, 757–765.
McGill, T.J., Douglas, R.M., Lund, R.D. & Prusky, G.T. ~2004!.
Quantification of spatial vision in the Royal College of Surgeons rat.
Investigative Ophthalmology & Visual Science 45, 932–936.
Morgans, C.W., Bayley, P.R., Oesch, N.W., Ren, G., Akileswaran, L.
& Taylor, W.R. ~2005!. Photoreceptor calcium channels: Insight from
night blindness. Visual Neuroscience 22, 561–568.
Morgans, C.W., Ren, G. & Akileswaran, L. ~2006!. Localization of
nyctalopin in the mammalian retina. European Journal of Neuroscience
23, 1163–1171.
Nirenberg, S., Carcieri, S.M., Jacobs, A.L. & Latham, P.E. ~2001!.
Retinal ganglion cells act largely as independent encoders. Nature 411,
698–701.
Nirenberg, S. & Meister, M. ~1997!. The light response of retinal
ganglion cells is truncated by a displaced amacrine circuit. Neuron 18,
637–650.
O’Connor, E., Allen, L.E., Bradshaw, K., Boylan, J., Moore, A.T. &
Trump, D. ~2006!. Congenital stationary night blindness associated
with mutations in GRM6 encoding glutamate receptor MGluR6. British
Journal of Ophthalmology 90, 653–654.
Pardue, M.T., McCall, M.A., LaVail, M.M., Gregg, R.G. & Peachey,
N.S. ~1998!. A naturally occurring mouse model of X-linked congenital
stationary night blindness. Investigative Ophthalmology & Visual Sci-
ence 39, 2443–2449.
Pinto, L.H., Vitaterna, M.H., Shimomura, K., Siepka, S.M., McDear-
mon, E.L., Fenner, D., Lumayag, S.L., Omura, C., Andrews, A.W.,
Baker, M., Invergo, B.M., Olvera, M.A., Heffron, E., Mullins,
R.F., Sheffield, V.C., Stone, E.M. & Takahashi, J.S. ~2005!. Gen-
eration, characterization, and molecular cloning of the Noerg-1 muta-
tion of rhodopsin in the mouse. Visual Neuroscience 22, 619–629.
Pinto, L.H., Vitaterna, M.H., Siepka, S.M., Shimomura, K., Lu-
mayag, S., Baker, M., Fenner, D., Mullins, R.F., Sheffield, V.C.,
Fig. 10. Comparison of the time course of development of acuity ~upper panels! and peak contrast sensitivity ~0.064 c0deg, lower
panels! of WT and nob4 mutant mice. These variables were measured from shortly after eye opening until PND 49 for both photopic
~left panels, 58.5 cd0m2! and scotopic ~right panels, 3.2 102 cd0m2! luminances. Note that the mutants did not attain the same values
of acuity or contrast sensitivity that are attained by WT mice.
122 L.H. Pinto et al.
Page 13
hidden
Stone, E.M., Heffron, E. & Takahashi, J.S. ~2004!. Results from
screening over 9000 mutation-bearing mice for defects in the electro-
retinogram and appearance of the fundus. Vision Research 44,
3335–3345.
Renteria, R.C., Tian, N., Cang, J., Nakanishi, S., Stryker, M. &
Copenhagen, M. ~2006!. Intrinsic ON responses of the retinal OFF
pathway are suppressed by the ON pathway. Journal of Neuroscience
26, 11857–11869
Rosemond, E., Wang, M., Yao, Y., Storjohann, L., Stormann, T.,
Johnson, E.C. & Hampson, D.R. ~2004!. Molecular basis for the
differential agonist affinities of group III metabotropic glutamate re-
ceptors. Molecular Pharmacology 66, 834–842.
Sagdullaev, B.T. & McCall, M.A. ~2005!. Stimulus size and intensity
alter fundamental receptive-field properties of mouse retinal ganglion
cells in vivo. Visual Neuroscience 22, 649–659.
Saszik, S.M., Robson, J.G. & Frishman, L.J. ~2002!. The scotopic thresh-
old response of the dark-adapted electroretinogram of the mouse. The
Journal of Physiology 543, 899–916.
Sharon, D., Vorobiov, D. & Dascal, N. ~1997!. Positive and negative
coupling of the metabotropic glutamate receptors to a G protein-
activated K channel, GIRK, in Xenopus oocytes. The Journal of
General Physiology 109, 477–490.
Shimbo, K., Brassard, D.L., Lamb, R.A. & Pinto, L.H. ~1996!. Ion
selectivity and activation of the M2 ion channel of influenza virus.
Biophysical Journal 70, 1335–1346.
Siepka, S.M. & Takahashi, J.S. ~2005!. Forward genetic screen to identify
circadian rhythmmutants in mice. Methods in Enzymology 393, 217–228.
Slaughter, M.M. & Miller, R.F. ~1981!. 2-amino-4-phosphonobutyric
acid: a new pharmacological tool for retina research. Science 211,
182–185.
Stern-Bach, Y., Bettler, B., Hartley, M., Sheppard, P.O., O’Hara,
P.J. & Heinemann, S.F. ~1994!. Agonist selectivity of glutamate re-
ceptors is specified by two domains structurally related to bacterial
amino acid-binding proteins. Neuron 13, 1345–1357.
Vitaterna, M.H., Pinto, L.H. & Takahashi, J.S. ~2006!. Large-scale
mutagenesis and phenotypic screens for the nervous system and be-
havior in mice. Trends in Neuroscience 29, 233–240.
Zeitz, C., van Genderen, M., Neidhardt, J., Luhmann, U.F., Hoeben,
F., Forster, U., Wycisk, K., Matyas, G., Hoyng, C.B., Riemslag, F.,
Meire, F., Cremers, F.P. & Berger, W. ~2005!. Mutations in GRM6
cause autosomal recessive congenital stationary night blindness with a
distinctive scotopic 15-Hz flicker electroretinogram. Investigative Oph-
thalmology & Visual Science 46, 4328–4335.
nob4 mutation of Grm6 in the mouse 123

Sign up today - FREE

Mendeley saves you time finding and organizing research. Learn more

  • All your research in one place
  • Add and import papers easily
  • Access it anywhere, anytime

Start using Mendeley in seconds!

Already have an account? Sign in

Readership Statistics

6 Readers on Mendeley
by Discipline
 
by Academic Status
 
50% Professor
 
33% Post Doc
 
17% Ph.D. Student
by Country
 
83% United States
 
17% Spain