Giant nuclei is essential in the cell cycle transition from meiosis to mitosis
Development Cambridge England (2003)
- PubMed: 12756181
Available from dev.biologists.org
or
Abstract
At the transition from meiosis to cleavage mitoses, Drosophila requires the cell cycle regulators encoded by the genes, giant nuclei (gnu), plutonium (plu) and pan gu (png). Embryos lacking Gnu protein undergo DNA replication and centrosome proliferation without chromosome condensation or mitotic segregation. We have identified the gnu gene encoding a novel phosphoprotein dephosphorylated by Protein phosphatase 1 at egg activation. Gnu is normally expressed in the nurse cells and oocyte of the ovary and is degraded during the embryonic cleavage mitoses. Ovarian death and sterility result from gnu gain of function. gnu function requires the activity of pan gu and plu.
Available from dev.biologists.org
Page 1
Giant nuclei is essential in the cell cycle transition from meiosis to mitosis
Open Research Online
The Open University’s repository of research publications
and other research outputs
Giant nuclei is essential in the cell cycle transition from
meiosis to mitosis
Journal Article
How to cite:
Renault, Andrew D.; Zhang, Xiao-Hua; Alphey, Luke S.; Frenz, Lisa M.; Glover, David M.; Saunders,
Robert D. C. and Axton, J. Myles (2003). Giant nuclei is essential in the cell cycle transition from meiosis to
mitosis. Development, 130(13), pp. 2997–3005.
For guidance on citations see FAQs.
c© [not recorded]
Version: [not recorded]
Link(s) to article on publisher’s website:
http://dx.doi.org/doi:10.1242/10.1242/dev.00501
http://dev.biologists.org/cgi/content/abstract/130/13/2997
Copyright and Moral Rights for the articles on this site are retained by the individual authors and/or other copy-
right owners. For more information on Open Research Online’s data policy on reuse of materials please consult
the policies page.
oro.open.ac.uk
The Open University’s repository of research publications
and other research outputs
Giant nuclei is essential in the cell cycle transition from
meiosis to mitosis
Journal Article
How to cite:
Renault, Andrew D.; Zhang, Xiao-Hua; Alphey, Luke S.; Frenz, Lisa M.; Glover, David M.; Saunders,
Robert D. C. and Axton, J. Myles (2003). Giant nuclei is essential in the cell cycle transition from meiosis to
mitosis. Development, 130(13), pp. 2997–3005.
For guidance on citations see FAQs.
c© [not recorded]
Version: [not recorded]
Link(s) to article on publisher’s website:
http://dx.doi.org/doi:10.1242/10.1242/dev.00501
http://dev.biologists.org/cgi/content/abstract/130/13/2997
Copyright and Moral Rights for the articles on this site are retained by the individual authors and/or other copy-
right owners. For more information on Open Research Online’s data policy on reuse of materials please consult
the policies page.
oro.open.ac.uk
Page 2
INTRODUCTION
Natural developmental mechanisms ensure that oocytes and
eggs arrest to await fertilization. These exhibit remarkable
evolutionary flexibility, with different species using a variety of
discrete arrest points, illustrating the diversity of regulatory
mechanisms that have evolved to arrest the fundamental cell
cycle oscillator (Sagata, 1996). The Drosophila oocyte is
normally arrested by its chiasmate chromosomes at metaphase
of the first meiotic division (Jang et al., 1995). Movement of
the oocyte into the oviduct is accompanied by its hydration and
activation (Heifetz et al., 2001) to complete both meiotic
divisions resulting in three polar bodies and one female
pronucleus that share a common cytoplasm. In unfertilised eggs,
the four meiotic products arrest with condensed chromosomes.
At fertilization, Cdks and their activators are present in
excess in the Drosophila embryo as a result of maternal
provisioning. From mitotic cycle 8, global Cyclin A and B
levels oscillate, generating fluctuations in Cdk1 activity (Edgar
et al., 1994). However, prior to cycle 8 the global levels of
Cyclin A and B appear not to oscillate and global Cdk1 levels
and activity, as measured by histone H1 kinase levels and
tyrosine phosphorylation status, are constant (Edgar et al.,
1994). Recent evidence suggests that Cyclin degradation and
Cdk activity oscillation are localised (Su et al., 1998; Huang
and Raff, 1999), which may explain how syncytial nuclei are
able to exit mitosis despite the presence of high Cyclin levels
and Cdk1 activity in the rest of the embryo.
plu, png and gnu are three genes required maternally to
inhibit DNA replication in the unfertilised egg and to couple S
phase and mitosis in the subsequent embryonic cleavage cycles
(Freeman et al., 1986; Freeman and Glover, 1987; Shamanski
and Orr-Weaver, 1991; Axton et al., 1994; Elfring et al., 1997;
Fenger et al., 2000). Regardless of embryonic genotype,
oocytes, eggs and embryos derived from plu, png or gnu
homozygous females will be referred to here as plu, png or gnu
oocytes, eggs or embryos.
Pan gu and Plu co-immunoprecipitate from egg and embryo
extracts suggesting they act in a complex. However, the level
of Plu is reduced in null png mutants (Elfring et al., 1997)
leaving open the possibility that Plu is a downstream effector
of Pan gu. The levels of the mitotic Cyclins A and B and Cdk1
kinase activity are decreased in embryonic extracts mutant for
png, gnu or plu (Fenger et al., 2000) providing a link between
the giant nuclei phenotype with known cell cycle regulators. In
addition, a genetic screen for png genetic interactors identified
enhancement by cyclin B. Experimental restoration of Cyclin
B levels in a png background was able to restore polar body
chromosome condensation, though the zygotic nuclei
eventually became polyploid (Lee et al., 2001). Thus Cyclin B
is a critical, but probably not the sole, target of png, plu and
gnu action. Here we describe the cloning of the gnu gene. We
also describe an analysis of the gnu over-replication phenotype
and investigate gnu function using epitope-tagged constructs.
MATERIALS AND METHODS
Drosophila stocks and libraries
Stocks (Lindsley and Zimm, 1992) were maintained at 25 ° C under
2997Development 130, 2997-3005
© 2003 The Company of Biologists Ltd
doi:10.1242/dev.00501
At the transition from meiosis to cleavage mitoses,
Drosophila requires the cell cycle regulators encoded by the
genes, giant nuclei (gnu), plutonium (plu) and pan gu (png).
Embryos lacking Gnu protein undergo DNA replication
and centrosome proliferation without chromosome
condensation or mitotic segregation. We have identified
the gnu gene encoding a novel phosphoprotein
dephosphorylated by Protein phosphatase 1 at egg
activation. Gnu is normally expressed in the nurse cells and
oocyte of the ovary and is degraded during the embryonic
cleavage mitoses. Ovarian death and sterility result from
gnu gain of function. gnu function requires the activity of
pan gu and plu.
Key words: Drosophila melanogaster, Mitosis, DNA replication,
Fertilization, Oogenesis, Protein phosphatase 1.
SUMMARY
giant nuclei is essential in the cell cycle transition from meiosis to mitosis
Andrew D. Renault1,*, Xiao-Hua Zhang1, Luke S. Alphey1, Lisa M. Frenz2, David M. Glover3,
Robert D. C. Saunders4 and J. Myles Axton1,†
1Department of Zoology, University of Oxford, South Parks Road, Oxford, OX1 3PS, UK
2Polgen Division, Cyclacel, Babraham Bioincubator 405, Babraham Institute, Babraham, Cambridgeshire CB2 4AT, UK
3Department of Genetics, University of Cambridge, Downing Street, Cambridge, CB2 3EH, UK
4Department of Biological Sciences, The Open University, Walton Hall, Milton Keynes, MK7 6AA, UK
*Present address: Skirball Institute, Developmental Genetics Program, New York University Medical Center, 540 First Avenue, NY 10016, USA
†Author for correspondence (myles.axton@zoo.ox.ac.uk)
Accepted 14 March 2003
Natural developmental mechanisms ensure that oocytes and
eggs arrest to await fertilization. These exhibit remarkable
evolutionary flexibility, with different species using a variety of
discrete arrest points, illustrating the diversity of regulatory
mechanisms that have evolved to arrest the fundamental cell
cycle oscillator (Sagata, 1996). The Drosophila oocyte is
normally arrested by its chiasmate chromosomes at metaphase
of the first meiotic division (Jang et al., 1995). Movement of
the oocyte into the oviduct is accompanied by its hydration and
activation (Heifetz et al., 2001) to complete both meiotic
divisions resulting in three polar bodies and one female
pronucleus that share a common cytoplasm. In unfertilised eggs,
the four meiotic products arrest with condensed chromosomes.
At fertilization, Cdks and their activators are present in
excess in the Drosophila embryo as a result of maternal
provisioning. From mitotic cycle 8, global Cyclin A and B
levels oscillate, generating fluctuations in Cdk1 activity (Edgar
et al., 1994). However, prior to cycle 8 the global levels of
Cyclin A and B appear not to oscillate and global Cdk1 levels
and activity, as measured by histone H1 kinase levels and
tyrosine phosphorylation status, are constant (Edgar et al.,
1994). Recent evidence suggests that Cyclin degradation and
Cdk activity oscillation are localised (Su et al., 1998; Huang
and Raff, 1999), which may explain how syncytial nuclei are
able to exit mitosis despite the presence of high Cyclin levels
and Cdk1 activity in the rest of the embryo.
plu, png and gnu are three genes required maternally to
inhibit DNA replication in the unfertilised egg and to couple S
phase and mitosis in the subsequent embryonic cleavage cycles
(Freeman et al., 1986; Freeman and Glover, 1987; Shamanski
and Orr-Weaver, 1991; Axton et al., 1994; Elfring et al., 1997;
Fenger et al., 2000). Regardless of embryonic genotype,
oocytes, eggs and embryos derived from plu, png or gnu
homozygous females will be referred to here as plu, png or gnu
oocytes, eggs or embryos.
Pan gu and Plu co-immunoprecipitate from egg and embryo
extracts suggesting they act in a complex. However, the level
of Plu is reduced in null png mutants (Elfring et al., 1997)
leaving open the possibility that Plu is a downstream effector
of Pan gu. The levels of the mitotic Cyclins A and B and Cdk1
kinase activity are decreased in embryonic extracts mutant for
png, gnu or plu (Fenger et al., 2000) providing a link between
the giant nuclei phenotype with known cell cycle regulators. In
addition, a genetic screen for png genetic interactors identified
enhancement by cyclin B. Experimental restoration of Cyclin
B levels in a png background was able to restore polar body
chromosome condensation, though the zygotic nuclei
eventually became polyploid (Lee et al., 2001). Thus Cyclin B
is a critical, but probably not the sole, target of png, plu and
gnu action. Here we describe the cloning of the gnu gene. We
also describe an analysis of the gnu over-replication phenotype
and investigate gnu function using epitope-tagged constructs.
MATERIALS AND METHODS
Drosophila stocks and libraries
Stocks (Lindsley and Zimm, 1992) were maintained at 25 ° C under
2997Development 130, 2997-3005
© 2003 The Company of Biologists Ltd
doi:10.1242/dev.00501
At the transition from meiosis to cleavage mitoses,
Drosophila requires the cell cycle regulators encoded by the
genes, giant nuclei (gnu), plutonium (plu) and pan gu (png).
Embryos lacking Gnu protein undergo DNA replication
and centrosome proliferation without chromosome
condensation or mitotic segregation. We have identified
the gnu gene encoding a novel phosphoprotein
dephosphorylated by Protein phosphatase 1 at egg
activation. Gnu is normally expressed in the nurse cells and
oocyte of the ovary and is degraded during the embryonic
cleavage mitoses. Ovarian death and sterility result from
gnu gain of function. gnu function requires the activity of
pan gu and plu.
Key words: Drosophila melanogaster, Mitosis, DNA replication,
Fertilization, Oogenesis, Protein phosphatase 1.
SUMMARY
giant nuclei is essential in the cell cycle transition from meiosis to mitosis
Andrew D. Renault1,*, Xiao-Hua Zhang1, Luke S. Alphey1, Lisa M. Frenz2, David M. Glover3,
Robert D. C. Saunders4 and J. Myles Axton1,†
1Department of Zoology, University of Oxford, South Parks Road, Oxford, OX1 3PS, UK
2Polgen Division, Cyclacel, Babraham Bioincubator 405, Babraham Institute, Babraham, Cambridgeshire CB2 4AT, UK
3Department of Genetics, University of Cambridge, Downing Street, Cambridge, CB2 3EH, UK
4Department of Biological Sciences, The Open University, Walton Hall, Milton Keynes, MK7 6AA, UK
*Present address: Skirball Institute, Developmental Genetics Program, New York University Medical Center, 540 First Avenue, NY 10016, USA
†Author for correspondence (myles.axton@zoo.ox.ac.uk)
Accepted 14 March 2003
Page 3
2998
standard conditions (Roberts and Standen, 1998). The single extant
gnu mutation [(Freeman et al., 1986) Tübingen stock gnu305] was
produced in a screen for female steriles by EMS mutagenesis of
ru th st kniri roe pp es ca. gnu complemented Df(3L)fzD21 and
Df(3L)BrdR15 but was uncovered by Df(3L)fzM21 and Df(3L)D5rv5.
The phage library was constructed by C. Gonzalez in BamHI-cleaved
l DASH (Stratagene). The cosmids were in NotBamNot CosPer vector
(Tamkun et al., 1992) and Lorist6 (Siden-Kiamos et al., 1990).
P-element induced male recombination
gnu was mapped by P-element induced male recombination (Chen et
al., 1998) relative to Trls2325 (a P-element insertion verified by inverse
PCR). The gnu stock ru gnu kniri th pp es / TM3 Sb has visible flanking
markers ru and kni[ri]. The source of transposase was Delta2-3 CyO.
Six independent recombinant chromosomes were recovered and all
indicated that gnu is proximal relative to Trls2325.
Transgenes
A 3.5 kb XbaI fragment from phage clone 23.13.3 was transferred into
the XbaI site of pCaSpeR4 (Sambrook et al., 1989). This comprised
the complete ORF of CG5272, with 1.6 kb of 5 ¢ and 0.9 kb 3¢ sequence
and the CG5258 (NHP2) coding region including the stop codon but
lacking the 3 ¢ UTR. This construct, inserted (Spradling, 1986) on the
second chromosome (F1I) and an independent insertion (M2A)
restored fertility to homozygous gnu females such that they produced
fertile adult progeny. The premature stop codon and SpeI site were
introduced by site-directed mutagenesis using the QuikChange ä
(Stratagene) strategy with the primers CTGAGGCAGGAGGAAT-
ACTAGTTGAAAAGTGCGCG and CGCGCACTTTTCAACTAG-
TATTCCTCCTGCCTCAG. The mutated fragment was cloned into
EcoRI/XbaI-cut pCaSpeR4. This construct inserted on the second
chromosome (stock GS3A) and independent insertion (GS2B) did not
rescue the sterility of homozygous gnu females. The eggs laid by such
females failed to undergo any normal cleavage cycles and all
developed giant nuclei.
Production of GFP-tagged gnu constructs
The 3.5 kb XbaI fragment in pBluescript SK was treated to remove
the downstream CG5258 (NHP2) gene and destroy a vector BamHI
site, by PmeI/BamHI digestion, end filling and re-ligation. A gnu 3¢
BamHI site was created by site-directed mutagenesis with the primers
GCCAAGCAATTCTTCGGATCCTATATCCTGTAGG and CCTA-
CAGGATATAGGATCCGAAGAATTGCTTGGC. Enhanced GFP
(Cormack et al., 1996) was amplified using the restriction site-tagged
primers CGGGATCCAAAGGAGAAGAACTTTTCACTG and CG-
GGATCCTATTTGTATAGTTCATCCATGC and inserted into the new
gnu 3¢ BamHI site. The entire insert was amplified by PCR using the
restriction enzyme-tagged primers GCTCTAGAGCTCAGCTGTT-
TCTTAGCC and GGAATTCAAGCATACTAGCGTGCCGC and the
product was inserted into EcoRI/XbaI-digested pCaSpeR4 to create a
genomic gnu-GFP construct. This construct, inserted on the second
chromosome, restored fertility to homozygous gnu females (GG4c).
Eggs laid by such females hatched and produced fertile adults. The
rescue was complete since no giant nuclei were observed in
unfertilised eggs or fertilised embryos from homozygous gnu females
with the construct.
For Gnu-GFP mis-expression, a UASp gnu-GFP construct was
produced by PCR using the restriction-tagged primers AAGGA-
AAAAAGCGGCCGCATTATTTGTAAAATTACCG and GCTCT-
AGAGGATCCTATTTGTATAGTTC and the genomic gnu-GFP
construct as a template. The fragment was subcloned into NotI/XbaI-
cut pSK. The fragment was excised and inserted into NotI/XbaI-cut
UASp (Rørth, 1998). The inserts of all transformation constructs were
sequenced in their entirety and no coding changes were found.
Embryo and ovary fixation, staining and microscopy
Protocols were from Sullivan et al. (Sullivan et al., 2000). Pictures
were taken using an Eclipse 800 microscope (Nikon) with a MRC
Radiance Plus laser scanning confocal system (Biorad) and
LaserSharp software (Biorad) or a Nikon Optiphot attached to the
BioRad MRC600 confocal microscope head. A Kahlman-averaging
filter was used to reduce background. Our observations of GFP
fluorescence are significant, since they were compared with
identically-fixed oocytes and embryos not containing the gnu-GFP
transgene and imaged with identical confocal settings.
DNA was stained with propidium iodide, primary antibodies used
were YL1/2 rat IgG anti-alpha tubulin 1 m g/m l (Serotec Ltd) used at
1:500 dilution; T47 mouse monoclonal anti-lamin (Frasch et al.,
1986), rabbit polyclonal against Drosophila PCNA antigen (Ng et al.,
1990) 1:500; mouse monoclonal anti-bromodeoxyuridine (BrdU:
Becton Dickinson). Secondary antibodies (Jackson) used were
fluorescein (FITC)-conjugated AffiniPure F(ab¢ )2 fragment donkey
anti-rat IgG (H+L) minimal cross reaction diluted to 1:400, the
equivalent FITC anti-rabbit was used for PCNA, FITC anti-mouse for
lamin and BrdU. For Fig. 1D, embryos were treated with 0.5 mg/ml
BrdU in Schneider’s Drosophila medium for 5 minutes.
Protein extracts and immunoblots
Proteins were extracted in 50 mM Tris-HCl pH 6.8, 100 mM NaCl,
1 mM benzamidine-HCl, 1 mM phenylmethylsulphonyl fluoride
(PMSF), 2 mM dithiothreitol (DTT), 1 mM Na3VO4, 50 mM NaF, 10
mM b -glycerophosphate on ice. An equal volume of 2 · SDS loading
buffer was added and the sample boiled for 5 minutes. The
phosphorylated form (in the ovary) and the dephosphorylated form (in
the embryo) of Gnu and of Gnu-GFP were detected in the absence of
phosphatase inhibitors but the phosphorylated form was not stable in
unboiled extracts without their use. The samples were centrifuged
at 20,000 g. Supernatants were separated on 10% 37.5:1
(acrylamide/methylenebisacrylamide), 0.1% SDS, pH 8.8 gels and
transferred to PVDF by semi-dry electrophoresis. All blots were
standardised by amount of material (embryos or ovaries) loaded, blots
were checked for protein loading by Indian ink staining and
subsequently re-blotted with anti-actin antibody as an internal loading
control. Rabbit anti-Gnu-peptide antiserum Rb86 (Moravian
Biotechnology) was preabsorbed on fixed 5- to 24-hour embryos
and used at 1:2000 dilution, mouse anti-GFP monoclonal antibody
(Zymed) was used at a 1:750 dilution and detected using a peroxidase-
conjugated secondary (Vector) at a 1:30,000 dilution and Supersignal
substrate (Pierce).
RESULTS
gnu eggs and embryos develop giant polyploid
nuclei in which DNA replication is uncoupled from
nuclear division
DNA replication in gnu eggs and embryos might be
continuous or cyclic, with gaps in which there is no
replication. To determine between these possibilities, we
examined the distribution of the DNA polymerase- d
processivity factor, PCNA (Yamaguchi et al., 1991) and
nuclear lamins in gnu embryos. In gnu embryos, the majority
of giant nuclei stained for PCNA indicating that they were in
S phase. However PCNA was excluded from a number of
nuclei (Fig. 1A,B) even in the presence of a nucleus
containing PCNA within the same embryo, suggesting that
giant nuclei exit S phase and that the nuclei in a single gnu
embryo do not always cycle in synchrony. The majority of the
nuclei were surrounded by an intact lamina but occasionally,
giant nuclei were observed in which the nuclear lamins had
dissociated (data not shown).
When BrdU incorporation was used to detect DNA
A. D. Renault and others
standard conditions (Roberts and Standen, 1998). The single extant
gnu mutation [(Freeman et al., 1986) Tübingen stock gnu305] was
produced in a screen for female steriles by EMS mutagenesis of
ru th st kniri roe pp es ca. gnu complemented Df(3L)fzD21 and
Df(3L)BrdR15 but was uncovered by Df(3L)fzM21 and Df(3L)D5rv5.
The phage library was constructed by C. Gonzalez in BamHI-cleaved
l DASH (Stratagene). The cosmids were in NotBamNot CosPer vector
(Tamkun et al., 1992) and Lorist6 (Siden-Kiamos et al., 1990).
P-element induced male recombination
gnu was mapped by P-element induced male recombination (Chen et
al., 1998) relative to Trls2325 (a P-element insertion verified by inverse
PCR). The gnu stock ru gnu kniri th pp es / TM3 Sb has visible flanking
markers ru and kni[ri]. The source of transposase was Delta2-3 CyO.
Six independent recombinant chromosomes were recovered and all
indicated that gnu is proximal relative to Trls2325.
Transgenes
A 3.5 kb XbaI fragment from phage clone 23.13.3 was transferred into
the XbaI site of pCaSpeR4 (Sambrook et al., 1989). This comprised
the complete ORF of CG5272, with 1.6 kb of 5 ¢ and 0.9 kb 3¢ sequence
and the CG5258 (NHP2) coding region including the stop codon but
lacking the 3 ¢ UTR. This construct, inserted (Spradling, 1986) on the
second chromosome (F1I) and an independent insertion (M2A)
restored fertility to homozygous gnu females such that they produced
fertile adult progeny. The premature stop codon and SpeI site were
introduced by site-directed mutagenesis using the QuikChange ä
(Stratagene) strategy with the primers CTGAGGCAGGAGGAAT-
ACTAGTTGAAAAGTGCGCG and CGCGCACTTTTCAACTAG-
TATTCCTCCTGCCTCAG. The mutated fragment was cloned into
EcoRI/XbaI-cut pCaSpeR4. This construct inserted on the second
chromosome (stock GS3A) and independent insertion (GS2B) did not
rescue the sterility of homozygous gnu females. The eggs laid by such
females failed to undergo any normal cleavage cycles and all
developed giant nuclei.
Production of GFP-tagged gnu constructs
The 3.5 kb XbaI fragment in pBluescript SK was treated to remove
the downstream CG5258 (NHP2) gene and destroy a vector BamHI
site, by PmeI/BamHI digestion, end filling and re-ligation. A gnu 3¢
BamHI site was created by site-directed mutagenesis with the primers
GCCAAGCAATTCTTCGGATCCTATATCCTGTAGG and CCTA-
CAGGATATAGGATCCGAAGAATTGCTTGGC. Enhanced GFP
(Cormack et al., 1996) was amplified using the restriction site-tagged
primers CGGGATCCAAAGGAGAAGAACTTTTCACTG and CG-
GGATCCTATTTGTATAGTTCATCCATGC and inserted into the new
gnu 3¢ BamHI site. The entire insert was amplified by PCR using the
restriction enzyme-tagged primers GCTCTAGAGCTCAGCTGTT-
TCTTAGCC and GGAATTCAAGCATACTAGCGTGCCGC and the
product was inserted into EcoRI/XbaI-digested pCaSpeR4 to create a
genomic gnu-GFP construct. This construct, inserted on the second
chromosome, restored fertility to homozygous gnu females (GG4c).
Eggs laid by such females hatched and produced fertile adults. The
rescue was complete since no giant nuclei were observed in
unfertilised eggs or fertilised embryos from homozygous gnu females
with the construct.
For Gnu-GFP mis-expression, a UASp gnu-GFP construct was
produced by PCR using the restriction-tagged primers AAGGA-
AAAAAGCGGCCGCATTATTTGTAAAATTACCG and GCTCT-
AGAGGATCCTATTTGTATAGTTC and the genomic gnu-GFP
construct as a template. The fragment was subcloned into NotI/XbaI-
cut pSK. The fragment was excised and inserted into NotI/XbaI-cut
UASp (Rørth, 1998). The inserts of all transformation constructs were
sequenced in their entirety and no coding changes were found.
Embryo and ovary fixation, staining and microscopy
Protocols were from Sullivan et al. (Sullivan et al., 2000). Pictures
were taken using an Eclipse 800 microscope (Nikon) with a MRC
Radiance Plus laser scanning confocal system (Biorad) and
LaserSharp software (Biorad) or a Nikon Optiphot attached to the
BioRad MRC600 confocal microscope head. A Kahlman-averaging
filter was used to reduce background. Our observations of GFP
fluorescence are significant, since they were compared with
identically-fixed oocytes and embryos not containing the gnu-GFP
transgene and imaged with identical confocal settings.
DNA was stained with propidium iodide, primary antibodies used
were YL1/2 rat IgG anti-alpha tubulin 1 m g/m l (Serotec Ltd) used at
1:500 dilution; T47 mouse monoclonal anti-lamin (Frasch et al.,
1986), rabbit polyclonal against Drosophila PCNA antigen (Ng et al.,
1990) 1:500; mouse monoclonal anti-bromodeoxyuridine (BrdU:
Becton Dickinson). Secondary antibodies (Jackson) used were
fluorescein (FITC)-conjugated AffiniPure F(ab¢ )2 fragment donkey
anti-rat IgG (H+L) minimal cross reaction diluted to 1:400, the
equivalent FITC anti-rabbit was used for PCNA, FITC anti-mouse for
lamin and BrdU. For Fig. 1D, embryos were treated with 0.5 mg/ml
BrdU in Schneider’s Drosophila medium for 5 minutes.
Protein extracts and immunoblots
Proteins were extracted in 50 mM Tris-HCl pH 6.8, 100 mM NaCl,
1 mM benzamidine-HCl, 1 mM phenylmethylsulphonyl fluoride
(PMSF), 2 mM dithiothreitol (DTT), 1 mM Na3VO4, 50 mM NaF, 10
mM b -glycerophosphate on ice. An equal volume of 2 · SDS loading
buffer was added and the sample boiled for 5 minutes. The
phosphorylated form (in the ovary) and the dephosphorylated form (in
the embryo) of Gnu and of Gnu-GFP were detected in the absence of
phosphatase inhibitors but the phosphorylated form was not stable in
unboiled extracts without their use. The samples were centrifuged
at 20,000 g. Supernatants were separated on 10% 37.5:1
(acrylamide/methylenebisacrylamide), 0.1% SDS, pH 8.8 gels and
transferred to PVDF by semi-dry electrophoresis. All blots were
standardised by amount of material (embryos or ovaries) loaded, blots
were checked for protein loading by Indian ink staining and
subsequently re-blotted with anti-actin antibody as an internal loading
control. Rabbit anti-Gnu-peptide antiserum Rb86 (Moravian
Biotechnology) was preabsorbed on fixed 5- to 24-hour embryos
and used at 1:2000 dilution, mouse anti-GFP monoclonal antibody
(Zymed) was used at a 1:750 dilution and detected using a peroxidase-
conjugated secondary (Vector) at a 1:30,000 dilution and Supersignal
substrate (Pierce).
RESULTS
gnu eggs and embryos develop giant polyploid
nuclei in which DNA replication is uncoupled from
nuclear division
DNA replication in gnu eggs and embryos might be
continuous or cyclic, with gaps in which there is no
replication. To determine between these possibilities, we
examined the distribution of the DNA polymerase- d
processivity factor, PCNA (Yamaguchi et al., 1991) and
nuclear lamins in gnu embryos. In gnu embryos, the majority
of giant nuclei stained for PCNA indicating that they were in
S phase. However PCNA was excluded from a number of
nuclei (Fig. 1A,B) even in the presence of a nucleus
containing PCNA within the same embryo, suggesting that
giant nuclei exit S phase and that the nuclei in a single gnu
embryo do not always cycle in synchrony. The majority of the
nuclei were surrounded by an intact lamina but occasionally,
giant nuclei were observed in which the nuclear lamins had
dissociated (data not shown).
When BrdU incorporation was used to detect DNA
A. D. Renault and others
Page 4
2999Gnu regulates mitosis
replication in gnu embryos, some, but not all, of the giant
nuclei incorporated BrdU (Fig. 1C,D). Taken together, the
results from these cell cycle markers suggest that some nuclei
were in S phase whilst others in the same embryo were not and
that DNA replication in gnu embryos is cyclic or of limited
duration.
It was previously reported that, in gnu eggs and embryos,
the nuclei neither condense chromosomes nor divide but the
centrosomes replicate and organise asters apparently normally
(Freeman and Glover, 1987). We examined microtubule asters
in gnu eggs and embryos by staining with an antibody against
tubulin. We found that asters were indeed initiated in gnu
embryos in a regular array throughout the embryos, but that,
in unfertilised eggs, the tubulin coated the giant nuclei and no
asters were observed (Fig. 1E,F).
Gnu is a small novel protein
gnu lies between the distal breakpoint of Df(3L)fzD21 at 70E5-
6 and the distal breakpoint of Df(3L)BrdR15 at 71A1-2.
Microdissected clones of polytene chromosome DNA
(Saunders, 1990) from the region were used as starting points
to construct a genomic walk. By sequencing the ends of the
inserts of phage and cosmid clones, we anchored the walk to
the sequence of the Drosophila genome (Adams et al., 2000).
gnu was mapped proximal to Trl by P-element-induced male
recombination, placing gnu within a region of 131 kb and 10
predicted genes between Trl and the distal breakpoint of
Df(3L)BrdR15. Sequencing genes from the gnu chromosome
in this region revealed a C to T mutation in gene CG5272
resulting in a premature stop codon (Fig. 2). This mutation was
not present on other lines (fs(3)131-19 and fs(3)135-17,
Tübingen stock centre) made in the same mutagenesis screen
as gnu (data not shown).
In transgenic Drosophila, a 3.5 kb XbaI fragment from a
phage containing CG5272, complemented the female sterility
of the gnu mutation, however, transformants containing the
same construct, except for a premature stop codon introduced
into CG5272 by site-directed mutagenesis, did not rescue the
gnu mutation. Therefore gnu is CG5272.
cDNAs GM10421 and LD12084, corresponding to ESTs in
the BDGP database (http://www.fruitfly.org) that matched
CG5272 were sequenced, confirming that gnu is a small gene
with a single intron encoding a 240 amino acid protein with a
predicted molecular mass of 27 kDa (Fig. 2). The premature
stop codon in gnu mutants would produce a truncated protein
lacking the C-terminal 94 residues. The deduced Gnu sequence
was used to search the protein databases. No close matches
were found, therefore Gnu is a novel protein.
Gnu is specific for early development
Rabbit anti-Gnu antiserum Rb86, raised against a synthetic
peptide comprising aa117-131 is specific for Gnu and for Gnu-
GFP but does not recognise a truncated product of the gnu
mutant (Fig. 3A). The expression profile of a functional Gnu-
GFP fusion protein under the control of the gnu promoter was
examined by immunoblotting and detection with a
monoclonal antibody against GFP. Gnu-GFP was expressed
in ovaries and 0- to 3-hour embryos (Fig. 3A,B) and in
unfertilised eggs, but not in larval tissues or in adult testes (not
shown). The epitope-tagged protein had very similar
expression to native Gnu detected with an anti-peptide
antiserum, but had a somewhat longer half-life in cleavage
embryos. We did not detect Gnu in embryos more than 1 hour
after egg deposition (Fig. 3B), in larvae or in adult testes (not
shown). The mobility of Gnu and of Gnu-GFP from ovaries
was slower than from unfertilised eggs or embryos suggesting
Gnu is post-translationally modified. The mobility of the
embryonic isoform matched the predicted size of the fusion
protein (54 kDa). GFP mobility in extracts from ovaries and
embryos from a ubiquitin-driven GFP line were identical (data
not shown), therefore it is only the Gnu moiety of Gnu-GFP
that is modified.
Gnu is dephosphorylated upon egg activation
In ovary extracts with phosphatase inhibitors, the slow moving
form of Gnu-GFP was observed (Fig. 3A,C). If phosphatase
inhibitors were omitted from the ovary extraction, the amount
of slow moving form was reduced in favour of the fast moving
form with the same mobility as Gnu-GFP from embryos
(Fig. 3C). To ascertain which protein phosphatases (PPs)
are involved, specific inhibitors of serine/threonine protein
phosphatases were tested for their ability to stabilise the
slow moving form (Fig. 3C). Okadaic acid (OA) at low
concentration (1 nM), sufficient to inhibit PP2A, did not
Fig. 1. DNA replication in gnu embryos. (A-D) Fluorescently
immunostained eggs and embryos from gnu homozygous mothers. A
nuclear lamina surrounded each of the giant nuclei in one embryo
(A) but in this same embryo, only one nucleus stained for Drosophila
PCNA (B). In another embryo, (C) DNA staining revealed three
giant nuclei and, (D) following 5 minutes incubation, only one had
incorporated BrdU. This indicated that not all of the nuclei are in S
phase. (E,F) A 5 m m confocal section of an unfertilised egg (E) and
embryo (F) stained for b -tubulin in green and DNA in red.
Microtubule asters were initiated in the fertilised embryo from
duplicating centrosomes, but were not present in the unfertilised egg.
Scale bars: 50 m m (A-D), 25 m m (E,F) .
replication in gnu embryos, some, but not all, of the giant
nuclei incorporated BrdU (Fig. 1C,D). Taken together, the
results from these cell cycle markers suggest that some nuclei
were in S phase whilst others in the same embryo were not and
that DNA replication in gnu embryos is cyclic or of limited
duration.
It was previously reported that, in gnu eggs and embryos,
the nuclei neither condense chromosomes nor divide but the
centrosomes replicate and organise asters apparently normally
(Freeman and Glover, 1987). We examined microtubule asters
in gnu eggs and embryos by staining with an antibody against
tubulin. We found that asters were indeed initiated in gnu
embryos in a regular array throughout the embryos, but that,
in unfertilised eggs, the tubulin coated the giant nuclei and no
asters were observed (Fig. 1E,F).
Gnu is a small novel protein
gnu lies between the distal breakpoint of Df(3L)fzD21 at 70E5-
6 and the distal breakpoint of Df(3L)BrdR15 at 71A1-2.
Microdissected clones of polytene chromosome DNA
(Saunders, 1990) from the region were used as starting points
to construct a genomic walk. By sequencing the ends of the
inserts of phage and cosmid clones, we anchored the walk to
the sequence of the Drosophila genome (Adams et al., 2000).
gnu was mapped proximal to Trl by P-element-induced male
recombination, placing gnu within a region of 131 kb and 10
predicted genes between Trl and the distal breakpoint of
Df(3L)BrdR15. Sequencing genes from the gnu chromosome
in this region revealed a C to T mutation in gene CG5272
resulting in a premature stop codon (Fig. 2). This mutation was
not present on other lines (fs(3)131-19 and fs(3)135-17,
Tübingen stock centre) made in the same mutagenesis screen
as gnu (data not shown).
In transgenic Drosophila, a 3.5 kb XbaI fragment from a
phage containing CG5272, complemented the female sterility
of the gnu mutation, however, transformants containing the
same construct, except for a premature stop codon introduced
into CG5272 by site-directed mutagenesis, did not rescue the
gnu mutation. Therefore gnu is CG5272.
cDNAs GM10421 and LD12084, corresponding to ESTs in
the BDGP database (http://www.fruitfly.org) that matched
CG5272 were sequenced, confirming that gnu is a small gene
with a single intron encoding a 240 amino acid protein with a
predicted molecular mass of 27 kDa (Fig. 2). The premature
stop codon in gnu mutants would produce a truncated protein
lacking the C-terminal 94 residues. The deduced Gnu sequence
was used to search the protein databases. No close matches
were found, therefore Gnu is a novel protein.
Gnu is specific for early development
Rabbit anti-Gnu antiserum Rb86, raised against a synthetic
peptide comprising aa117-131 is specific for Gnu and for Gnu-
GFP but does not recognise a truncated product of the gnu
mutant (Fig. 3A). The expression profile of a functional Gnu-
GFP fusion protein under the control of the gnu promoter was
examined by immunoblotting and detection with a
monoclonal antibody against GFP. Gnu-GFP was expressed
in ovaries and 0- to 3-hour embryos (Fig. 3A,B) and in
unfertilised eggs, but not in larval tissues or in adult testes (not
shown). The epitope-tagged protein had very similar
expression to native Gnu detected with an anti-peptide
antiserum, but had a somewhat longer half-life in cleavage
embryos. We did not detect Gnu in embryos more than 1 hour
after egg deposition (Fig. 3B), in larvae or in adult testes (not
shown). The mobility of Gnu and of Gnu-GFP from ovaries
was slower than from unfertilised eggs or embryos suggesting
Gnu is post-translationally modified. The mobility of the
embryonic isoform matched the predicted size of the fusion
protein (54 kDa). GFP mobility in extracts from ovaries and
embryos from a ubiquitin-driven GFP line were identical (data
not shown), therefore it is only the Gnu moiety of Gnu-GFP
that is modified.
Gnu is dephosphorylated upon egg activation
In ovary extracts with phosphatase inhibitors, the slow moving
form of Gnu-GFP was observed (Fig. 3A,C). If phosphatase
inhibitors were omitted from the ovary extraction, the amount
of slow moving form was reduced in favour of the fast moving
form with the same mobility as Gnu-GFP from embryos
(Fig. 3C). To ascertain which protein phosphatases (PPs)
are involved, specific inhibitors of serine/threonine protein
phosphatases were tested for their ability to stabilise the
slow moving form (Fig. 3C). Okadaic acid (OA) at low
concentration (1 nM), sufficient to inhibit PP2A, did not
Fig. 1. DNA replication in gnu embryos. (A-D) Fluorescently
immunostained eggs and embryos from gnu homozygous mothers. A
nuclear lamina surrounded each of the giant nuclei in one embryo
(A) but in this same embryo, only one nucleus stained for Drosophila
PCNA (B). In another embryo, (C) DNA staining revealed three
giant nuclei and, (D) following 5 minutes incubation, only one had
incorporated BrdU. This indicated that not all of the nuclei are in S
phase. (E,F) A 5 m m confocal section of an unfertilised egg (E) and
embryo (F) stained for b -tubulin in green and DNA in red.
Microtubule asters were initiated in the fertilised embryo from
duplicating centrosomes, but were not present in the unfertilised egg.
Scale bars: 50 m m (A-D), 25 m m (E,F) .
Page 5
3000
stabilise slow moving Gnu-GFP, however OA at a higher
concentration (50 nM), sufficient to inhibit PP1 (Mackintosh
and Mackintosh, 1994), stabilised slow moving Gnu-GFP. I-
2Dm, a specific inhibitor of PP1 (Bennett et al., 1999), also
stabilised slow moving Gnu-GFP. We conclude that PP1 can
dephosphorylate Gnu in ovary extracts.
To determine the developmental time-point at which Gnu
dephosphorylation occurs, we crossed the genomic gnu-GFP
transgene into mutant backgrounds that cause the oocyte to
arrest development during meiosis [cortex and grauzone (Page
and Orr-Weaver, 1996)], or immediately following meiosis but
prior to the first zygotic mitosis [deadhead (Pellicena-Palle et
al., 1997)]. Gnu-GFP mobility in ovaries and eggs in these
mutant backgrounds was indistinguishable from wild-type
(Fig. 3D) indicating that Gnu is dephosphorylated before
meiotic arrest induced by cortex and grauzone, most likely at
egg activation.
Gnu accumulates in oocytes of stage 11 egg
chambers and is cytoplasmic in eggs and
embryos
In ovaries, Gnu-GFP was first observed in fixed
oocytes of stage 11 egg chambers (Fig. 4A). In
subsequent stages it accumulated in the oocyte but
was not observed in nurse cells (Fig. 4B). In eggs,
Gnu-GFP was cytoplasmic and showed no
association with the replicatively inactive polar body
chromosomes (Fig. 4C,D). In syncytial embryos
Gnu-GFP was again cytoplasmic at all stages of the
cell cycle. Although the nuclear envelope stains
somewhat more distinctly, Gnu is neither strongly
localised within, nor excluded from zygotic nuclei
(Fig. 4E,F).
Gnu post-translational modifications are not
dependent on pgn
Gnu-GFP mobility in ovaries and eggs in both null
and weak png backgrounds was indistinguishable
from wild type (Fig. 3E). Therefore, Pan gu is neither
the kinase that phosphorylates Gnu nor part of a pathway
leading to Gnu dephosphorylation. Even if Pan gu does not
influence Gnu modification, it might regulate Gnu localisation.
To test this possibility we examined Gnu-GFP localisation in
a png background. We found that Gnu was cytoplasmic in png
embryos and it was excluded from the giant nuclei (Fig. 4G-
I).
Gnu mis-expression in the ovarian germline results
in sterility
We mis-expressed Gnu-GFP in Drosophila ovaries using the
UAS-GAL4 system (Rørth, 1998; Brand and Perrimon, 1993).
Females containing the maternal alpha4tubulin>GAL4:VP16
driver and UASp gnu-GFP (see Materials and Methods) were
sterile and did not lay eggs. Staining of their ovaries revealed
Gnu-GFP was expressed from stage 5 onwards (Fig. 5A). Egg
chambers up to stages 8-10 had wild-type morphology.
A. D. Renault and others
1 taaggatcgtttttcagcactgatcatggttctatgactaggattttatgagttgcctga 60
61 tcacagaattttcggtaattttaaccgctcttaatgcggtcgcattaaaaaagcagttaa 120
121 ttacagttagttgcattttgCAAATCTTATTGCACGTTTTTTTTTGTCGTCTTTTTTGTG 180
181 CTCGTGGAAAATATTATTTGTAAAATTACCGAATGGAGCGCTACAATCGCGTCTATAGAG 240
1 M E R Y N R V Y R 9
241 gtagtattgctaatacttttgtaaacaagtttaaaatatatcctttaactttcaatagAT 300
10 D 10
301 CCCGCATCCCCACTGACCCCACTCACTCCCCTCTCCACCGAAGCTTTTACATTCGAAGAT 360
11 P A S P L T P L T P L S T E A F T F E D 30
361 GTCACGCCCACTGGAGGCGTTGGCAGGAAGGGTACCGCGAGATACGGACTCTTTGGAATG 420
31 V T P T G G V G R K G T A R Y G L F G M 50
421 CCGAAGAACAATAATCTTACGGTTCCTAACAGTCGACCGGCATTGTCCGGGTTAAAACGA 480
51 P K N N N L T V P N S R P A L S G L K R 70
481 CTATCGGAATCCACTTTGCCCCGTCGATTTTCACAGAAATTTATGCGCACGCGTTCCGTA 540
71 L S E S T L P R R F S Q K F M R T R S V 90
541 TTTTCGCCCACAAGTCAAAGTACCCTTATAAATGGGGAGACCAGGCTACTGGGAGAATCT 600
91 F S P T S Q S T L I N G E T R L L G E S 110
601 GGAGATTCGAAACTACTGAGAACTAAGAGAGAAGACAGACCAAAGCCGGATATCCGACTG 660
111 G D S K L L R T K R E D R P K P D I R L 130
661 CAGCAGGAAACGCGGCTGAGGCAGGAGGAATC CA AGTTGAAAAGTGCGC GAAAGATTAAA 720
131 Q Q E T R L R Q E E S K L K S A R K I K 150
721 GTGGAGGACCCAAGAAGTCCCACTCCCAGTATCCATCATTCACGCTATAAGCCCTGCTCC 780
151 V E D P R S P T P S I H H S R Y K P C S 170
781 CCGGTGGAGCACCCCACTTTGAGTCCTCGGGTCAAATCCCTGCTCGATCGCACCGGAAAC 840
171 P V E H P T L S P R V K S L L D R T G N 190
841 GCGCATCTCACAGAGCTGTTCACGCGCCAGGAGATCGACATCGAGGTGCTCATCCAAATG 900
191 A H L T E L F T R Q E I D I E V L I Q M 210
901 ACCCTGGAGGACTTGGCGGCACTGGGCGTTCGCGGCGCCCGGGAGATCCGATTGGCCATG 960
211 T L E D L A A L G V R G A R E I R L A M 230
961 AATATTATCCAACTGGCCAAGCAATTCTTCTGATTTTATATCCTGTAGGATTTCTGCTAA 1020
231 N I I Q L A K Q F F * 240
1021 TTTTAAACTGTTTTATGTCATGTGGATTTGAATTTGTATGTGAGATTTT AATAAA TGTTT 1080
1081 AATGTGGTCTTGaagtatttttgcgc
Fig. 2. gnu DNA and deduced protein sequence (EMBL
Accession Number AJ557828). The genomic sequence of
gnu from an isogenic y; cn bw sp stock (Adams et al.,
2000) is shown with the exons in upper case and the
predicted amino acid sequence shown below the DNA
sequence. The consensus splice sites are in italic and the
polyadenylation signal is doubly underlined. The site of
the C to T mutation on the gnu chromosome (base 709) is
indicated by a solid black box. The ESTs GM10421 and
LD12084 begin at bases 141 and 151 respectively
(denoted by •). On sequencing gnu from OregonR and
from our genomic rescue construct the following
polymorphisms were found: 91 T fi C and 113 Gfi A, 165
extra T in our genomic rescue construct (numbers refer to
bases with y; cn bw sp version first and polymorphism
second). All of these polymorphisms are in untranslated
regions except 324 C fi A in OregonR which is a silent
mutation in the coding sequence. Overall there is no
polymorphism in the deduced protein sequence. The
residues altered in the production of gnuSTOP (boxed),
were 692 C fi A and 694 Afi T, resulting in a premature
TAG stop codon in place of the lysine at 142 and a SpeI
site (ACTAGT).
stabilise slow moving Gnu-GFP, however OA at a higher
concentration (50 nM), sufficient to inhibit PP1 (Mackintosh
and Mackintosh, 1994), stabilised slow moving Gnu-GFP. I-
2Dm, a specific inhibitor of PP1 (Bennett et al., 1999), also
stabilised slow moving Gnu-GFP. We conclude that PP1 can
dephosphorylate Gnu in ovary extracts.
To determine the developmental time-point at which Gnu
dephosphorylation occurs, we crossed the genomic gnu-GFP
transgene into mutant backgrounds that cause the oocyte to
arrest development during meiosis [cortex and grauzone (Page
and Orr-Weaver, 1996)], or immediately following meiosis but
prior to the first zygotic mitosis [deadhead (Pellicena-Palle et
al., 1997)]. Gnu-GFP mobility in ovaries and eggs in these
mutant backgrounds was indistinguishable from wild-type
(Fig. 3D) indicating that Gnu is dephosphorylated before
meiotic arrest induced by cortex and grauzone, most likely at
egg activation.
Gnu accumulates in oocytes of stage 11 egg
chambers and is cytoplasmic in eggs and
embryos
In ovaries, Gnu-GFP was first observed in fixed
oocytes of stage 11 egg chambers (Fig. 4A). In
subsequent stages it accumulated in the oocyte but
was not observed in nurse cells (Fig. 4B). In eggs,
Gnu-GFP was cytoplasmic and showed no
association with the replicatively inactive polar body
chromosomes (Fig. 4C,D). In syncytial embryos
Gnu-GFP was again cytoplasmic at all stages of the
cell cycle. Although the nuclear envelope stains
somewhat more distinctly, Gnu is neither strongly
localised within, nor excluded from zygotic nuclei
(Fig. 4E,F).
Gnu post-translational modifications are not
dependent on pgn
Gnu-GFP mobility in ovaries and eggs in both null
and weak png backgrounds was indistinguishable
from wild type (Fig. 3E). Therefore, Pan gu is neither
the kinase that phosphorylates Gnu nor part of a pathway
leading to Gnu dephosphorylation. Even if Pan gu does not
influence Gnu modification, it might regulate Gnu localisation.
To test this possibility we examined Gnu-GFP localisation in
a png background. We found that Gnu was cytoplasmic in png
embryos and it was excluded from the giant nuclei (Fig. 4G-
I).
Gnu mis-expression in the ovarian germline results
in sterility
We mis-expressed Gnu-GFP in Drosophila ovaries using the
UAS-GAL4 system (Rørth, 1998; Brand and Perrimon, 1993).
Females containing the maternal alpha4tubulin>GAL4:VP16
driver and UASp gnu-GFP (see Materials and Methods) were
sterile and did not lay eggs. Staining of their ovaries revealed
Gnu-GFP was expressed from stage 5 onwards (Fig. 5A). Egg
chambers up to stages 8-10 had wild-type morphology.
A. D. Renault and others
1 taaggatcgtttttcagcactgatcatggttctatgactaggattttatgagttgcctga 60
61 tcacagaattttcggtaattttaaccgctcttaatgcggtcgcattaaaaaagcagttaa 120
121 ttacagttagttgcattttgCAAATCTTATTGCACGTTTTTTTTTGTCGTCTTTTTTGTG 180
181 CTCGTGGAAAATATTATTTGTAAAATTACCGAATGGAGCGCTACAATCGCGTCTATAGAG 240
1 M E R Y N R V Y R 9
241 gtagtattgctaatacttttgtaaacaagtttaaaatatatcctttaactttcaatagAT 300
10 D 10
301 CCCGCATCCCCACTGACCCCACTCACTCCCCTCTCCACCGAAGCTTTTACATTCGAAGAT 360
11 P A S P L T P L T P L S T E A F T F E D 30
361 GTCACGCCCACTGGAGGCGTTGGCAGGAAGGGTACCGCGAGATACGGACTCTTTGGAATG 420
31 V T P T G G V G R K G T A R Y G L F G M 50
421 CCGAAGAACAATAATCTTACGGTTCCTAACAGTCGACCGGCATTGTCCGGGTTAAAACGA 480
51 P K N N N L T V P N S R P A L S G L K R 70
481 CTATCGGAATCCACTTTGCCCCGTCGATTTTCACAGAAATTTATGCGCACGCGTTCCGTA 540
71 L S E S T L P R R F S Q K F M R T R S V 90
541 TTTTCGCCCACAAGTCAAAGTACCCTTATAAATGGGGAGACCAGGCTACTGGGAGAATCT 600
91 F S P T S Q S T L I N G E T R L L G E S 110
601 GGAGATTCGAAACTACTGAGAACTAAGAGAGAAGACAGACCAAAGCCGGATATCCGACTG 660
111 G D S K L L R T K R E D R P K P D I R L 130
661 CAGCAGGAAACGCGGCTGAGGCAGGAGGAATC CA AGTTGAAAAGTGCGC GAAAGATTAAA 720
131 Q Q E T R L R Q E E S K L K S A R K I K 150
721 GTGGAGGACCCAAGAAGTCCCACTCCCAGTATCCATCATTCACGCTATAAGCCCTGCTCC 780
151 V E D P R S P T P S I H H S R Y K P C S 170
781 CCGGTGGAGCACCCCACTTTGAGTCCTCGGGTCAAATCCCTGCTCGATCGCACCGGAAAC 840
171 P V E H P T L S P R V K S L L D R T G N 190
841 GCGCATCTCACAGAGCTGTTCACGCGCCAGGAGATCGACATCGAGGTGCTCATCCAAATG 900
191 A H L T E L F T R Q E I D I E V L I Q M 210
901 ACCCTGGAGGACTTGGCGGCACTGGGCGTTCGCGGCGCCCGGGAGATCCGATTGGCCATG 960
211 T L E D L A A L G V R G A R E I R L A M 230
961 AATATTATCCAACTGGCCAAGCAATTCTTCTGATTTTATATCCTGTAGGATTTCTGCTAA 1020
231 N I I Q L A K Q F F * 240
1021 TTTTAAACTGTTTTATGTCATGTGGATTTGAATTTGTATGTGAGATTTT AATAAA TGTTT 1080
1081 AATGTGGTCTTGaagtatttttgcgc
Fig. 2. gnu DNA and deduced protein sequence (EMBL
Accession Number AJ557828). The genomic sequence of
gnu from an isogenic y; cn bw sp stock (Adams et al.,
2000) is shown with the exons in upper case and the
predicted amino acid sequence shown below the DNA
sequence. The consensus splice sites are in italic and the
polyadenylation signal is doubly underlined. The site of
the C to T mutation on the gnu chromosome (base 709) is
indicated by a solid black box. The ESTs GM10421 and
LD12084 begin at bases 141 and 151 respectively
(denoted by •). On sequencing gnu from OregonR and
from our genomic rescue construct the following
polymorphisms were found: 91 T fi C and 113 Gfi A, 165
extra T in our genomic rescue construct (numbers refer to
bases with y; cn bw sp version first and polymorphism
second). All of these polymorphisms are in untranslated
regions except 324 C fi A in OregonR which is a silent
mutation in the coding sequence. Overall there is no
polymorphism in the deduced protein sequence. The
residues altered in the production of gnuSTOP (boxed),
were 692 C fi A and 694 Afi T, resulting in a premature
TAG stop codon in place of the lysine at 142 and a SpeI
site (ACTAGT).
Page 6
3001Gnu regulates mitosis
However subsequent stages were characterised by large
amounts of irregularly localised, often fragmented, chromatin
resulting from the degeneration of nurse cell nuclei. No stage
14 egg chambers could be distinguished. Suprisingly, given
that Gnu-GFP, expressed from its own promoter, was
unlocalised in embryos, mis-expressed Gnu-GFP was
exclusively nuclear in nurse cells (Fig. 5D-F).
Control females containing the same driver and a UASp
GFP construct had wild-type ovarian morphology and were
fertile (Fig. 5B). GFP was present throughout their nurse
cells, though the nuclei had slightly higher levels than
the cytoplasm (Fig. 5B). We concluded that GFP does not
show particular affinity for nurse cell nuclei or impede
oogenesis, therefore the nuclear accumulation and sterility
arising from Gnu-GFP mis-expression resulted from the Gnu
moiety.
We compared the mobility of ectopic Gnu-GFP from ovaries
to that of Gnu-GFP from ovaries expressing the genomic
construct. Mis-expressed Gnu-GFP from ovaries was identical
to the dephosphorylated embryonic form (Fig. 5G). Thus nurse
cells do not phosphorylate Gnu, suggesting that the Gnu kinase
activity is restricted to the oocyte.
To test whether the sterility associated with Gnu mis-
expression was a consequence of Gnu alone, we mis-expressed
Gnu in ovaries in a png mutant background. Females
homozygous for png1058 and containing the maternal
alpha4tubulin>GAL4:VP16 and UASp gnu-GFP constructs
laid eggs (Table 1). Staining of their ovaries revealed they were
morphologically normal with no abnormal egg chambers or
fragmented DNA (Fig. 5C). The egg laying rates for such
Fig. 3. Developmental expression and post-translational
modification. (A) Immunoblot with anti-peptide antiserum detected
native Gnu protein in wild type (w[1118]) Drosophila ovaries (O)
and 0-3 hour embryos (E) and detected functional Gnu-GFP fusion
protein in ovaries from stock GG4c: homozygous gnu, rescued by a
homozygous insertion of the genomic gnu-GFP construct (GG).
(B) Expression in staged 0- to 4-hour embryos of Gnu (anti-Gnu) in
w[1118] embryos (loading control: anti-actin), Gnu-GFP (anti-GFP)
in GG4c embryos. (C-E) Functional fusion protein detected with
anti-GFP antibody. (C) Proteins extracted from GG4c ovaries in the
presence of the protein phosphatase inhibitors fluoride (NaF),
orthovanadate (Na3VO4), b -glycerophosphate ( b GP), okadaic acid
(OA) and Inhibitor-2 (I-2Dm). (D) Extracts of ovaries, eggs and
embryos from flies containing a single insertion of the genomic gnu-
GFP construct in cortex (cort), grauzone (grau) and deadhead (dhd)
mutant backgrounds or wild-type control homozygous for the
genomic gnu-GFP construct. (E) Extracts of ovaries and embryos
from flies containing a single heterozygous insertion of the genomic
gnu-GFP construct in homozygous png backgrounds. png1058 and
png3318 are null and weak alleles respectively. The wild-type control
is from flies homozygous for the genomic gnu-GFP construct.
Fig. 4. Gnu localization in ovaries and embryos. Confocal sections of
ovaries from gnu females rescued by the homozygous genomic gnu-
GFP construct (stock GG4c). (A) Gnu-GFP fluorescence (green;
DNA stained red) was first observed in oocytes of stage 11 egg
chambers. (B) In subsequent stages, the fusion protein accumulated
in the oocyte but was not observed in nurse cells. (C) Gnu-GFP
fluorescence was not found to be specifically associated with the
polar bodies (D). (E-F) Syncytial embryo in interphase of cycle 10.
The Gnu-GFP fluorescence was cytoplasmic (E) and not excluded
from nuclei (F). (G-I) Confocal sections of a giant nucleus from flies
homozyogus for png3318 and also containing a single heterozygous
copy of the genomic gnu-GFP construct. (G) DNA, (H) Gnu-GFP
fluorescence, (I) merged image with DNA in red and Gnu-GFP
fluorescence in green. Scale bars: 100 m m (A,B), 10 m m (C-F),
20 m m (G-I).
However subsequent stages were characterised by large
amounts of irregularly localised, often fragmented, chromatin
resulting from the degeneration of nurse cell nuclei. No stage
14 egg chambers could be distinguished. Suprisingly, given
that Gnu-GFP, expressed from its own promoter, was
unlocalised in embryos, mis-expressed Gnu-GFP was
exclusively nuclear in nurse cells (Fig. 5D-F).
Control females containing the same driver and a UASp
GFP construct had wild-type ovarian morphology and were
fertile (Fig. 5B). GFP was present throughout their nurse
cells, though the nuclei had slightly higher levels than
the cytoplasm (Fig. 5B). We concluded that GFP does not
show particular affinity for nurse cell nuclei or impede
oogenesis, therefore the nuclear accumulation and sterility
arising from Gnu-GFP mis-expression resulted from the Gnu
moiety.
We compared the mobility of ectopic Gnu-GFP from ovaries
to that of Gnu-GFP from ovaries expressing the genomic
construct. Mis-expressed Gnu-GFP from ovaries was identical
to the dephosphorylated embryonic form (Fig. 5G). Thus nurse
cells do not phosphorylate Gnu, suggesting that the Gnu kinase
activity is restricted to the oocyte.
To test whether the sterility associated with Gnu mis-
expression was a consequence of Gnu alone, we mis-expressed
Gnu in ovaries in a png mutant background. Females
homozygous for png1058 and containing the maternal
alpha4tubulin>GAL4:VP16 and UASp gnu-GFP constructs
laid eggs (Table 1). Staining of their ovaries revealed they were
morphologically normal with no abnormal egg chambers or
fragmented DNA (Fig. 5C). The egg laying rates for such
Fig. 3. Developmental expression and post-translational
modification. (A) Immunoblot with anti-peptide antiserum detected
native Gnu protein in wild type (w[1118]) Drosophila ovaries (O)
and 0-3 hour embryos (E) and detected functional Gnu-GFP fusion
protein in ovaries from stock GG4c: homozygous gnu, rescued by a
homozygous insertion of the genomic gnu-GFP construct (GG).
(B) Expression in staged 0- to 4-hour embryos of Gnu (anti-Gnu) in
w[1118] embryos (loading control: anti-actin), Gnu-GFP (anti-GFP)
in GG4c embryos. (C-E) Functional fusion protein detected with
anti-GFP antibody. (C) Proteins extracted from GG4c ovaries in the
presence of the protein phosphatase inhibitors fluoride (NaF),
orthovanadate (Na3VO4), b -glycerophosphate ( b GP), okadaic acid
(OA) and Inhibitor-2 (I-2Dm). (D) Extracts of ovaries, eggs and
embryos from flies containing a single insertion of the genomic gnu-
GFP construct in cortex (cort), grauzone (grau) and deadhead (dhd)
mutant backgrounds or wild-type control homozygous for the
genomic gnu-GFP construct. (E) Extracts of ovaries and embryos
from flies containing a single heterozygous insertion of the genomic
gnu-GFP construct in homozygous png backgrounds. png1058 and
png3318 are null and weak alleles respectively. The wild-type control
is from flies homozygous for the genomic gnu-GFP construct.
Fig. 4. Gnu localization in ovaries and embryos. Confocal sections of
ovaries from gnu females rescued by the homozygous genomic gnu-
GFP construct (stock GG4c). (A) Gnu-GFP fluorescence (green;
DNA stained red) was first observed in oocytes of stage 11 egg
chambers. (B) In subsequent stages, the fusion protein accumulated
in the oocyte but was not observed in nurse cells. (C) Gnu-GFP
fluorescence was not found to be specifically associated with the
polar bodies (D). (E-F) Syncytial embryo in interphase of cycle 10.
The Gnu-GFP fluorescence was cytoplasmic (E) and not excluded
from nuclei (F). (G-I) Confocal sections of a giant nucleus from flies
homozyogus for png3318 and also containing a single heterozygous
copy of the genomic gnu-GFP construct. (G) DNA, (H) Gnu-GFP
fluorescence, (I) merged image with DNA in red and Gnu-GFP
fluorescence in green. Scale bars: 100 m m (A,B), 10 m m (C-F),
20 m m (G-I).
Page 7
3002
females were similar to wild type (Table 1) indicating that the
restoration of ovarian function was complete. The eggs did not
hatch but, when stained for chromatin, exhibited a giant nuclei
phenotype identical to that in Fig. 4G-I, typical of png
embryos. The earliest mis-expression and amount of Gnu-GFP
fluorescence in a png background was the same as in a wild-
type background indicating that the restoration of ovary
function is not caused by an effect of png on Gnu-GFP mis-
expression levels or timing. The effect of a homozygous null
plu mutation in combination with Gnu-GFP mis-expression
was indistinguishable from that of the null png mutation (Table
1).
Since the Gnu gain-of-function phenotype resembles that of
Profilin mutants (Cooley et al., 1992) we examined the actin
cytoskeleton of egg chambers (Fig. 6). Defects were first seen
at stage 10, when nurse cells mis-expressing Gnu failed to
assemble the actin meshwork and did not dump their
cytoplasmic contents into the oocyte. We do not know whether
the disruption of actin reorganisation is the primary
consequence of excess Gnu, or whether premature egg
chamber death results in the dramatically abnormal aggregates
of F-actin. What is clear from our epistasis experiments is that
this ‘dump-less’ phenotype is specific, in that it also requires
Pan gu and Plu.
A. D. Renault and others
Fig. 5. Gnu mis-expression in ovaries results in sterility. Confocal
sections of ovaries and egg chambers from females containing
(A,D-F) the maternal a 4 tubulin>GAL4:VP16 and UASp gnu-GFP,
(B) maternal a 4 tubulin>GAL4:VP16 with UASp EGFP constructs
in a wild-type background, (C) maternal a 4 tubulin> GAL4:VP16
with UASp gnu-GFP in a homozygous png1058 null background.
(A) Gnu-GFP mis-expressed in ovaries is nuclear and disrupts
oogenesis with inappropriate nurse cell degeneration and
fragmented chromatin (arrow). (B) Ectopic GFP is cytoplasmic and
nuclear and does not disrupt ovary morphology. (C) Ectopic Gnu-
GFP is largely nuclear but oogenesis is not disrupted and ovarian
morphology is normal. DNA is red and GFP fluorescence, green.
(D-F) A single stage 8 egg chamber. (D) Propidium iodide-stained
DNA, (E) GFP fluorescence, (F) merged image of D and E, with
DNA in red and Gnu-GFP fluorescence in green. Not all nurse cell
nuclei contain Gnu-GFP (arrowhead). Scale bars: 50 m m. (G) Anti-
GFP blot shows that Gnu-GFP expressed from the GAL4-UAS
system is unmodified, in contrast with that expressed from the
genomic gnu-GFP construct.
Fig. 6. Abnormal actin reorganisation in ovaries mis-expressing Gnu.
(A) Propidium-stained DNA, (B) FITC-phalloidin stain for F-actin.
(C) Merged image of A and B. DNA red, F-actin green. (D) Gnu-
GFP in nurse cell nuclei. (E) Rhodamine-phalloidin stain for F-actin.
(F) Merged image of D and E Gnu-GFP green, rhodamine-phalloidin
red. Gnu-GFP mis-expression was compatible with some aspects of
F-actin organisation, such as ring canals (E arrowhead, F). At the
equivalent of wild-type stage 10, the actin cytoskeleton aggregated
(E arrow) and did not develop the contractile meshwork
(B arrowhead, C) that in the wild type ovary dumps nurse cell
cytoplasm into the oocyte and retains nurse cell nuclei in oogenic
stages 10B and 11. Confocal sections were taken of egg chambers
from females containing the maternal a 4 tubulin>GAL4:VP16 (A-C)
and UASp gnu-GFP (D-F) constructs in wild-type background.
females were similar to wild type (Table 1) indicating that the
restoration of ovarian function was complete. The eggs did not
hatch but, when stained for chromatin, exhibited a giant nuclei
phenotype identical to that in Fig. 4G-I, typical of png
embryos. The earliest mis-expression and amount of Gnu-GFP
fluorescence in a png background was the same as in a wild-
type background indicating that the restoration of ovary
function is not caused by an effect of png on Gnu-GFP mis-
expression levels or timing. The effect of a homozygous null
plu mutation in combination with Gnu-GFP mis-expression
was indistinguishable from that of the null png mutation (Table
1).
Since the Gnu gain-of-function phenotype resembles that of
Profilin mutants (Cooley et al., 1992) we examined the actin
cytoskeleton of egg chambers (Fig. 6). Defects were first seen
at stage 10, when nurse cells mis-expressing Gnu failed to
assemble the actin meshwork and did not dump their
cytoplasmic contents into the oocyte. We do not know whether
the disruption of actin reorganisation is the primary
consequence of excess Gnu, or whether premature egg
chamber death results in the dramatically abnormal aggregates
of F-actin. What is clear from our epistasis experiments is that
this ‘dump-less’ phenotype is specific, in that it also requires
Pan gu and Plu.
A. D. Renault and others
Fig. 5. Gnu mis-expression in ovaries results in sterility. Confocal
sections of ovaries and egg chambers from females containing
(A,D-F) the maternal a 4 tubulin>GAL4:VP16 and UASp gnu-GFP,
(B) maternal a 4 tubulin>GAL4:VP16 with UASp EGFP constructs
in a wild-type background, (C) maternal a 4 tubulin> GAL4:VP16
with UASp gnu-GFP in a homozygous png1058 null background.
(A) Gnu-GFP mis-expressed in ovaries is nuclear and disrupts
oogenesis with inappropriate nurse cell degeneration and
fragmented chromatin (arrow). (B) Ectopic GFP is cytoplasmic and
nuclear and does not disrupt ovary morphology. (C) Ectopic Gnu-
GFP is largely nuclear but oogenesis is not disrupted and ovarian
morphology is normal. DNA is red and GFP fluorescence, green.
(D-F) A single stage 8 egg chamber. (D) Propidium iodide-stained
DNA, (E) GFP fluorescence, (F) merged image of D and E, with
DNA in red and Gnu-GFP fluorescence in green. Not all nurse cell
nuclei contain Gnu-GFP (arrowhead). Scale bars: 50 m m. (G) Anti-
GFP blot shows that Gnu-GFP expressed from the GAL4-UAS
system is unmodified, in contrast with that expressed from the
genomic gnu-GFP construct.
Fig. 6. Abnormal actin reorganisation in ovaries mis-expressing Gnu.
(A) Propidium-stained DNA, (B) FITC-phalloidin stain for F-actin.
(C) Merged image of A and B. DNA red, F-actin green. (D) Gnu-
GFP in nurse cell nuclei. (E) Rhodamine-phalloidin stain for F-actin.
(F) Merged image of D and E Gnu-GFP green, rhodamine-phalloidin
red. Gnu-GFP mis-expression was compatible with some aspects of
F-actin organisation, such as ring canals (E arrowhead, F). At the
equivalent of wild-type stage 10, the actin cytoskeleton aggregated
(E arrow) and did not develop the contractile meshwork
(B arrowhead, C) that in the wild type ovary dumps nurse cell
cytoplasm into the oocyte and retains nurse cell nuclei in oogenic
stages 10B and 11. Confocal sections were taken of egg chambers
from females containing the maternal a 4 tubulin>GAL4:VP16 (A-C)
and UASp gnu-GFP (D-F) constructs in wild-type background.
Page 8
3003Gnu regulates mitosis
DISCUSSION
We have mapped the gnu gene using chromosome walking and
P-element-mediated male recombination and have identified a
C to T nonsense mutation in gene CG5272 (Adams et al., 2000)
on the gnu chromosome. A wild-type copy of this gene rescued
the gnu mutant phenotype in transgenic Drosophila, whereas
transformants with the same fragment, but in which the ORF
had been mutagenised, did not complement the gnu mutation.
gnu is therefore gene CG5272 and encodes a novel 27 kDa
protein with no obvious domains or homologues shared with
other organisms.
Gnu phosphorylation
We deduce from its mobility shift on immunoblots that
Gnu is phosphorylated before it is needed in oocytes,
is dephosphorylated upon egg activation, and that this
phosphorylation is independent of Pan gu protein kinase
activity. A specific inhibitor of PP1, I-2, stabilised
phosphorylated Gnu in vitro, implicating PP1 as the relevant
phosphatase. Drosophila contains four PP1 genes of which
PP1 87B provides 80% of total PP1 activity (Dombrádi et al.,
1989) and is required for mitotic progression (Axton et al.,
1990), though none have previously been ascribed a role in egg
activation or fertilisation.
PP1 87B and PP2A28D mutations genetically suppress a
weak png allele (Lee et al., 2001) However, these data are not
consistent with our finding that PP1 activates Gnu. If
unphosphorylated embryonic Gnu is the active form and Gnu
and Pan gu act in the same pathway, then reducing the dose of
the activating phosphatase should enhance a png phenotype. It
may be that these phosphatases oppose png action directly by
dephosphorylating the Pan gu substrate (Lee et al., 2001) or
that they are the cell cycle regulators targeted by Gnu, Plu and
PnP as discussed below.
Gain-of-function phenotype
Gnu mis-expression using the UAS-Gal4 system (Rørth, 1998)
in Drosophila ovaries resulted in sterility due to an inability to
lay eggs. Dissection of the ovaries revealed that early oogenesis
was unaffected. Gnu was expressed in egg chambers from stage
5 onwards and was localised solely to the nurse cell nuclei. No
normal egg chambers could be discerned at stage 10 or later
when gross aberrations in the organisation of the actin
cytoskeleton resulted in failure to transfer nurse cell cytoplasm
into the oocyte. Gnu mobility from such ovaries was identical
to the dephosphorylated form suggesting that the protein kinase
that phosphorylates Gnu is not present or active in the nurse
cells.
Since gnu, plu and png mutations have the same phenotype,
we were previously unable to determine whether the gene
products act in series or in parallel. Here we have used
the dominant ovarian phenotype resulting from Gnu mis-
expression to investigate the epistasis of gnu, png and plu. Loss
of png or plu function blocked the ovarian phenotype caused
by Gnu mis-expression. This result implies that ectopic Gnu
destroys egg chambers only through Pan gu and Plu. It is
therefore likely that wild-type Gnu function in the egg and
embryo also requires Pan gu. Although Gnu-GFP is more
obviously excluded from the larger png giant nuclei (Fig. 4H)
than from zygotic nuclei (Fig. 4E) we do not favour the
explanation that Gnu requires Pan gu for nuclear localisation.
Firstly, Gnu-GFP is not specifically nuclear in wild-type
embryos (Fig. 4E) and secondly, in a png null ovary, ectopic
Gnu-GFP is able to concentrate in the polyploid nurse cell
nuclei (Fig. 6C). The remaining possibilities are that Gnu acts
upstream of Pan gu and Plu or that it acts in a complex with
Pan gu and Plu.
We have mis-expressed Gnu in polytene salivary glands
and ovarian follicle cells (data not shown). In both cases Gnu
was exclusively nuclear, but its expression had no obvious
effect on tissue morphology. However, not all nurse cell
nuclei in an egg chamber contained Gnu-GFP, suggesting that
that the presence of Gnu-GFP reflects the transcriptional
activity of the nucleus or depends upon its cell cycle status.
Why is Gnu nuclear in polytene cells and cytoplasmic in the
diploid syncytial blastoderm and larval neuroblasts (data not
shown)? Gnu contains no obvious nuclear import sequence,
suggesting that Gnu binds a factor that is cytoplasmic in eggs
and embryos (including those with giant nuclei; Fig. 4H), and
nuclear in polytene tissues. Polytene and diploid tissues have
different Cyclin profiles. Embryos are replete with maternal
Cyclins A, B and E whereas polytene tissues have no Cyclin
A or B (Lehner and O’Farrell, 1989; Lehner and O’Farrell,
1990; Richardson et al., 1993) and Cyclin E is expressed
periodically in nurse cell nuclei and constantly in the
Table 1. Epistasis of gnu with pgn and plu
Eggs/fly/day Eggs % surviving females
Genotype Mean s.d. Hydrated Hatched Phenotype 4 days 7 days n
OregonR 33.2 13.7 Yes Yes Wild type 100 100 13
png[1058]/png[1058] 21.5 10.6 Yes No png loss 100 92 13
w/w; mat a 4T GAL4VP16/UASp gnuEGFP 0.1 0.4 No No gnu gain 71 33 21
png[1058]/png[1058]; mata 4T GAL4VP16/UASp gnuEGFP 30.7 12.0 Yes No png loss 100 100 17
png[1058]/w; mata 4T GAL4VP16/UASp gnuEGFP 0.5 0.8 No No gnu gain 63 8 24
png[1058]/png[1058]; mata 4T GAL4VP16/UASp EGFP 24.8 7.8 Yes No png loss 100 100 12
png[1058]/w; mata 4T GAL4VP16/UASp EGFP 28.4 8.0 Yes Yes Wild type 100 100 7
w/w; mat a 4T GAL4VP16/UASp EGFP 30.7 9.4 Yes Yes Wild type 100 100 13
mata 4T GAL4VP16/w; UASp gnuEGFP/+ None No No gnu gain
mata 4T GAL4VP16/w; UASp gnuEGFP plu[6]/plu[6] Many Yes No plu loss
The gnu gain-of-function (gain) phenotype consisted of reduced lifespan, disintegrating ovary (Fig. 5A, Fig. 6D-F), few flaccid eggs were laid and these did
not hatch. The pgn null (loss) phenotype consisted of normal viability and ovarian morphology (Fig. 5C), many hydrated eggs with giant nuclei (similar to Fig.
4G-I) were laid and these did not hatch. The double mutant combination exhibited the pgn loss phenotype. Gnu overexpression combined with a null allele of plu
resulted in the plu loss phenotype.
DISCUSSION
We have mapped the gnu gene using chromosome walking and
P-element-mediated male recombination and have identified a
C to T nonsense mutation in gene CG5272 (Adams et al., 2000)
on the gnu chromosome. A wild-type copy of this gene rescued
the gnu mutant phenotype in transgenic Drosophila, whereas
transformants with the same fragment, but in which the ORF
had been mutagenised, did not complement the gnu mutation.
gnu is therefore gene CG5272 and encodes a novel 27 kDa
protein with no obvious domains or homologues shared with
other organisms.
Gnu phosphorylation
We deduce from its mobility shift on immunoblots that
Gnu is phosphorylated before it is needed in oocytes,
is dephosphorylated upon egg activation, and that this
phosphorylation is independent of Pan gu protein kinase
activity. A specific inhibitor of PP1, I-2, stabilised
phosphorylated Gnu in vitro, implicating PP1 as the relevant
phosphatase. Drosophila contains four PP1 genes of which
PP1 87B provides 80% of total PP1 activity (Dombrádi et al.,
1989) and is required for mitotic progression (Axton et al.,
1990), though none have previously been ascribed a role in egg
activation or fertilisation.
PP1 87B and PP2A28D mutations genetically suppress a
weak png allele (Lee et al., 2001) However, these data are not
consistent with our finding that PP1 activates Gnu. If
unphosphorylated embryonic Gnu is the active form and Gnu
and Pan gu act in the same pathway, then reducing the dose of
the activating phosphatase should enhance a png phenotype. It
may be that these phosphatases oppose png action directly by
dephosphorylating the Pan gu substrate (Lee et al., 2001) or
that they are the cell cycle regulators targeted by Gnu, Plu and
PnP as discussed below.
Gain-of-function phenotype
Gnu mis-expression using the UAS-Gal4 system (Rørth, 1998)
in Drosophila ovaries resulted in sterility due to an inability to
lay eggs. Dissection of the ovaries revealed that early oogenesis
was unaffected. Gnu was expressed in egg chambers from stage
5 onwards and was localised solely to the nurse cell nuclei. No
normal egg chambers could be discerned at stage 10 or later
when gross aberrations in the organisation of the actin
cytoskeleton resulted in failure to transfer nurse cell cytoplasm
into the oocyte. Gnu mobility from such ovaries was identical
to the dephosphorylated form suggesting that the protein kinase
that phosphorylates Gnu is not present or active in the nurse
cells.
Since gnu, plu and png mutations have the same phenotype,
we were previously unable to determine whether the gene
products act in series or in parallel. Here we have used
the dominant ovarian phenotype resulting from Gnu mis-
expression to investigate the epistasis of gnu, png and plu. Loss
of png or plu function blocked the ovarian phenotype caused
by Gnu mis-expression. This result implies that ectopic Gnu
destroys egg chambers only through Pan gu and Plu. It is
therefore likely that wild-type Gnu function in the egg and
embryo also requires Pan gu. Although Gnu-GFP is more
obviously excluded from the larger png giant nuclei (Fig. 4H)
than from zygotic nuclei (Fig. 4E) we do not favour the
explanation that Gnu requires Pan gu for nuclear localisation.
Firstly, Gnu-GFP is not specifically nuclear in wild-type
embryos (Fig. 4E) and secondly, in a png null ovary, ectopic
Gnu-GFP is able to concentrate in the polyploid nurse cell
nuclei (Fig. 6C). The remaining possibilities are that Gnu acts
upstream of Pan gu and Plu or that it acts in a complex with
Pan gu and Plu.
We have mis-expressed Gnu in polytene salivary glands
and ovarian follicle cells (data not shown). In both cases Gnu
was exclusively nuclear, but its expression had no obvious
effect on tissue morphology. However, not all nurse cell
nuclei in an egg chamber contained Gnu-GFP, suggesting that
that the presence of Gnu-GFP reflects the transcriptional
activity of the nucleus or depends upon its cell cycle status.
Why is Gnu nuclear in polytene cells and cytoplasmic in the
diploid syncytial blastoderm and larval neuroblasts (data not
shown)? Gnu contains no obvious nuclear import sequence,
suggesting that Gnu binds a factor that is cytoplasmic in eggs
and embryos (including those with giant nuclei; Fig. 4H), and
nuclear in polytene tissues. Polytene and diploid tissues have
different Cyclin profiles. Embryos are replete with maternal
Cyclins A, B and E whereas polytene tissues have no Cyclin
A or B (Lehner and O’Farrell, 1989; Lehner and O’Farrell,
1990; Richardson et al., 1993) and Cyclin E is expressed
periodically in nurse cell nuclei and constantly in the
Table 1. Epistasis of gnu with pgn and plu
Eggs/fly/day Eggs % surviving females
Genotype Mean s.d. Hydrated Hatched Phenotype 4 days 7 days n
OregonR 33.2 13.7 Yes Yes Wild type 100 100 13
png[1058]/png[1058] 21.5 10.6 Yes No png loss 100 92 13
w/w; mat a 4T GAL4VP16/UASp gnuEGFP 0.1 0.4 No No gnu gain 71 33 21
png[1058]/png[1058]; mata 4T GAL4VP16/UASp gnuEGFP 30.7 12.0 Yes No png loss 100 100 17
png[1058]/w; mata 4T GAL4VP16/UASp gnuEGFP 0.5 0.8 No No gnu gain 63 8 24
png[1058]/png[1058]; mata 4T GAL4VP16/UASp EGFP 24.8 7.8 Yes No png loss 100 100 12
png[1058]/w; mata 4T GAL4VP16/UASp EGFP 28.4 8.0 Yes Yes Wild type 100 100 7
w/w; mat a 4T GAL4VP16/UASp EGFP 30.7 9.4 Yes Yes Wild type 100 100 13
mata 4T GAL4VP16/w; UASp gnuEGFP/+ None No No gnu gain
mata 4T GAL4VP16/w; UASp gnuEGFP plu[6]/plu[6] Many Yes No plu loss
The gnu gain-of-function (gain) phenotype consisted of reduced lifespan, disintegrating ovary (Fig. 5A, Fig. 6D-F), few flaccid eggs were laid and these did
not hatch. The pgn null (loss) phenotype consisted of normal viability and ovarian morphology (Fig. 5C), many hydrated eggs with giant nuclei (similar to Fig.
4G-I) were laid and these did not hatch. The double mutant combination exhibited the pgn loss phenotype. Gnu overexpression combined with a null allele of plu
resulted in the plu loss phenotype.
Page 9
3004
germinal vesicle (Lilly and Spradling, 1996). Our
observations fit the Cyclin E pattern, ectopic Gnu was not
present in all nurse or follicle cell nuclei and was
concentrated in germinal vesicles.
Downstream targets of giant nuclei genes
The DNA replication in gnu embryos resembles the
endoreduplication observed in Drosophila ovarian nurse cells
and larval salivary glands and this raises the question of how
the normal mechanisms that license DNA replication once per
cell cycle are subverted in gnu embryos. In yeast, Cdk1
activity, modulated by Cyclin levels, is responsible for resetting
replication origins (Hayles et al., 1994) raising the possibility
that over-replication in gnu embryos may result from
inappropriate Cdk1 activity. Indeed, in gnu, plu or png
embryos, levels of Cyclin A and B proteins and Cdk1 activity
are reduced (Fenger et al., 2000). Restored Cyclin B levels can
suppress a weak png mutation (Lee et al., 2001).
Several features of early Drosophila embryogenesis may
have necessitated the evolution of these specialised regulators
of the cell cycle. Firstly, distinct cell cycle fates befall the
polar body and zygotic nuclei within a common cytoplasm.
Secondly, many cell cycle regulators are in excess, so that the
first 13 cycles are rapid and lack G1 or G2 phases, but S and
M phases must alternate accurately. Finally, correct cell cycle
regulation is achieved by a small subset of the available cell
cycle control proteins (e.g. Cyclins A and B) (Edgar et al.,
1994). In this context, Gnu, Plu and Pan gu act coordinately to
ensure that the cell cycle oscillations experienced by the nuclei
are temporally and locally apt.
This work was initiated in the Department of Biochemistry,
Imperial College London, continued at the University of Dundee,
before being brought to its present conclusion in the Zoology
Department at Oxford. We are extremely grateful to the Cancer
Research Campaign (now Cancer Research UK) for Core Programme
support to D.M.G. and Project Grant support to J.M.A. D.M.G. and
R.D.C.S. also received Medical Research Council (MRC) Project
Grant support when at Imperial College, and X.-H.Z., J.M.A. and
L.S.A. are currently members of an MRC Co-operative Group (with
MRC Project Grant support to J.M.A.) in Oxford. During the course
of this work, L.M.F. received a support to study for the PhD degree
of the University of Dundee from the Science and Engineering
Research Council, now long metamorphosed into the Biotechnology
and Biological Sciences Research Council. A.D.R. was supported by
the States of Jersey for DPhil studies at the University of Oxford. We
would like to thank Pernille Rørth for the UASp vector; Adelaide
Carpenter, Peter Duchek, János Gausz, Terry Orr-Weaver, Daniel St.
Johnston, Bloomington and Tübingen stock centres for fly stocks;
Ruth Lehmann and Helen White-Cooper for help and advice; and
Balázs Szöór for the I-2Dm protein.
REFERENCES
Adams, M. D., Celniker, S. E., Holt, R. A., Evans, C. A. Gocayne, J. D.,
Amanatides, P. G., Scherer, S. E., Li, P. W., Hoskins, R. A., Galle, R. F.
et al. (2000). The genome sequence of Drosophila melanogaster. Science
287, 2185-2195.
Axton, J. M., Dombrádi, V., Cohen, P. T. W. and Glover, D. M. (1990). One
of the Protein Phosphatase-1 isoenzymes in Drosophila is essential for
mitosis. Cell 63, 33-46.
Axton, J. M., Shamanski, F., Young, L., Henderson, D., Boyd, J. and Orr-
Weaver, T. (1994). The inhibitor of DNA replication encoded by the
Drosophila gene plutonium is a small, ankyrin repeat protein. EMBO J. 13,
462-470.
Bennett, D., Szöór, B. and Alphey, L. (1999). The chaperone-like properties
of mammalian inhibitor-2 are conserved in a Drosophila homologue.
Biochemistry 38, 16276-16282.
Brand, A. H. and Perrimon, N. (1993). Targeted gene expression as a means
of altering cell fates and generating dominant phenotypes. Development 118,
401-415.
Chen, B., Chu, T., Harms, E., Gergen, J. and Strickland, S. (1998).
Mapping of Drosophila mutations using site-specific male recombination.
Genetics 149, 157-163.
Cooley, L. Verheyen, E. and Ayers, K. (1992). chickadee encodes a Profilin
required for intercellular cytoplasm transport during Drosophila oogenesis.
Cell 69, 173-184.
Cormack, B. P., Valdivia, R. H. and Falkow, S. (1996). FACS-optimized
mutants of the green fluorescent protein GFP. Gene 173, 33-38.
Dombrádi, V., Axton, J. M., Glover, D. M. and Cohen, P. T. W. (1989).
Cloning and chromosomal localization of Drosophila cDNA encoding the
catalytic subunit of protein phosphatase-1-alpha: high conservation between
mammalian and insect sequences. Eur. J. Biochem. 183, 603-610.
Edgar, B., Sprenger, F., Duronio, R., Leopold, P. and O’Farrell, P. (1994).
Distinct molecular mechanisms regulate cell-cycle timing at successive
stages of Drosophila embryogenesis. Genes Dev. 8, 440-452.
Elfring, L., Axton, J., Fenger, D., Page, A., Carminati, J. and Orr-Weaver,
T. (1997). Drosophila Plutonium protein is a specialized cell cycle regulator
required at the onset of embryogenesis. Mol. Biol. Cell 8, 583-593.
Fenger, D. D., Carminati, J. L., Burney-Sigman, D. L., Kashevsky, H.,
Dines, J. L., Elfring, L. K., Orr-Weaver, T. L (2000). PAN GU: a protein
kinase that inhibits S phase and promotes mitosis in early Drosophila
development. Development 127, 4763-4774.
Frasch, M., Glover, D. M. and Saumweber, H. (1986). Nuclear antigens
follow different pathways into daughter nuclei during mitosis in early
Drosophila embryos. J. Cell Sci. 82, 155-172.
Freeman, M. and Glover, D. (1987). The gnu mutation of Drosophila causes
inappropriate DNA synthesis in unfertilized and fertilized eggs. Genes Dev.
1, 924-930.
Freeman, M., Nüsslein-Volhard, C. and Glover, D. (1986). The dissociation
of nuclear and centrosomal division in gnu, a mutation causing giant nuclei
in Drosophila. Cell 46, 457-468.
Hayles, J. Fisher, D., Woollard, A. and Nurse, P. (1994). Temporal order of
S-phase and mitosis in fission yeast is determined by the state of the p34cdc2
mitotic B-cyclin complex. Cell 78, 813-822.
Heifetz, Y., Yu, J. and Wolfner, M. F. (2001). Ovulation triggers activation
of Drosophila oocytes. Dev. Biol. 234, 416-424.
Huang, J. and Raff, J. (1999). The disappearance of cyclin B at the end
of mitosis is regulated spatially in Drosophila cells. EMBO J. 18, 2184-
2195.
Jang, J. K., Messina, L., Erdman, M. B., Arbel, T. and Hawley, R. S.
(1995). Induction of metaphase arrest in Drosophila oocytes by chiasma-
based kinetochore tension. Science 268, 1917-1919.
Lee, L. A., Elfring, L. K., Bosco, G. and Orr-Weaver, T. L. (2001). A genetic
screen for suppressors and enhancers of the Drosophila PAN GU cell cycle
kinase identifies cyclin B as a target. Genetics 158, 1545-1556.
Lehner, C. F. and O’Farrell, P. H. (1989). Expression and function of
Drosophila cyclin-A during embryonic-cell cycle progression. Cell 56, 957-
968.
Lehner, C. F. and O’Farrell, P. H. (1990).The roles of Drosophila cyclin-A
and cyclin-B in mitotic control. Cell 61, 535-547.
Lilly, M. A. and Spradling, A. C. (1996).The Drosophila endocycle is
controlled by cyclin E and lacks a checkpoint ensuring S-phase completion.
Genes Dev. 10, 2514-2526.
Lindsley, D. L. and Zimm, G. G. (1992). The Genome of Drosophila
melanogaster. London: Academic Press.
Mackintosh, C. and Mackintosh, R. W. (1994). Inhibitors of protein kinases
and phosphatases. Trends Biochem. Sci. 19, 444-448.
Ng, L., Prelich, G., Anderson, C. W., Stillman, B. and Fisher, P. A. (1990)
Drosophila proliferating cell nuclear antigen – structural and functional
homology with its mammalian counterpart. J. Biol. Chem. 265, 11948-
11954.
Page, A. and Orr-Weaver, T. (1996). The Drosophila genes grauzone
and cortex are necessary for proper female meiosis. J. Cell Sci. 109,
1707-1715.
Pellicena-Palle, A., Stitzinger, S. M. and Salz, H. K. (1997). The function
of the Drosophila thioredoxin homologue encoded by the deadhead gene is
A. D. Renault and others
germinal vesicle (Lilly and Spradling, 1996). Our
observations fit the Cyclin E pattern, ectopic Gnu was not
present in all nurse or follicle cell nuclei and was
concentrated in germinal vesicles.
Downstream targets of giant nuclei genes
The DNA replication in gnu embryos resembles the
endoreduplication observed in Drosophila ovarian nurse cells
and larval salivary glands and this raises the question of how
the normal mechanisms that license DNA replication once per
cell cycle are subverted in gnu embryos. In yeast, Cdk1
activity, modulated by Cyclin levels, is responsible for resetting
replication origins (Hayles et al., 1994) raising the possibility
that over-replication in gnu embryos may result from
inappropriate Cdk1 activity. Indeed, in gnu, plu or png
embryos, levels of Cyclin A and B proteins and Cdk1 activity
are reduced (Fenger et al., 2000). Restored Cyclin B levels can
suppress a weak png mutation (Lee et al., 2001).
Several features of early Drosophila embryogenesis may
have necessitated the evolution of these specialised regulators
of the cell cycle. Firstly, distinct cell cycle fates befall the
polar body and zygotic nuclei within a common cytoplasm.
Secondly, many cell cycle regulators are in excess, so that the
first 13 cycles are rapid and lack G1 or G2 phases, but S and
M phases must alternate accurately. Finally, correct cell cycle
regulation is achieved by a small subset of the available cell
cycle control proteins (e.g. Cyclins A and B) (Edgar et al.,
1994). In this context, Gnu, Plu and Pan gu act coordinately to
ensure that the cell cycle oscillations experienced by the nuclei
are temporally and locally apt.
This work was initiated in the Department of Biochemistry,
Imperial College London, continued at the University of Dundee,
before being brought to its present conclusion in the Zoology
Department at Oxford. We are extremely grateful to the Cancer
Research Campaign (now Cancer Research UK) for Core Programme
support to D.M.G. and Project Grant support to J.M.A. D.M.G. and
R.D.C.S. also received Medical Research Council (MRC) Project
Grant support when at Imperial College, and X.-H.Z., J.M.A. and
L.S.A. are currently members of an MRC Co-operative Group (with
MRC Project Grant support to J.M.A.) in Oxford. During the course
of this work, L.M.F. received a support to study for the PhD degree
of the University of Dundee from the Science and Engineering
Research Council, now long metamorphosed into the Biotechnology
and Biological Sciences Research Council. A.D.R. was supported by
the States of Jersey for DPhil studies at the University of Oxford. We
would like to thank Pernille Rørth for the UASp vector; Adelaide
Carpenter, Peter Duchek, János Gausz, Terry Orr-Weaver, Daniel St.
Johnston, Bloomington and Tübingen stock centres for fly stocks;
Ruth Lehmann and Helen White-Cooper for help and advice; and
Balázs Szöór for the I-2Dm protein.
REFERENCES
Adams, M. D., Celniker, S. E., Holt, R. A., Evans, C. A. Gocayne, J. D.,
Amanatides, P. G., Scherer, S. E., Li, P. W., Hoskins, R. A., Galle, R. F.
et al. (2000). The genome sequence of Drosophila melanogaster. Science
287, 2185-2195.
Axton, J. M., Dombrádi, V., Cohen, P. T. W. and Glover, D. M. (1990). One
of the Protein Phosphatase-1 isoenzymes in Drosophila is essential for
mitosis. Cell 63, 33-46.
Axton, J. M., Shamanski, F., Young, L., Henderson, D., Boyd, J. and Orr-
Weaver, T. (1994). The inhibitor of DNA replication encoded by the
Drosophila gene plutonium is a small, ankyrin repeat protein. EMBO J. 13,
462-470.
Bennett, D., Szöór, B. and Alphey, L. (1999). The chaperone-like properties
of mammalian inhibitor-2 are conserved in a Drosophila homologue.
Biochemistry 38, 16276-16282.
Brand, A. H. and Perrimon, N. (1993). Targeted gene expression as a means
of altering cell fates and generating dominant phenotypes. Development 118,
401-415.
Chen, B., Chu, T., Harms, E., Gergen, J. and Strickland, S. (1998).
Mapping of Drosophila mutations using site-specific male recombination.
Genetics 149, 157-163.
Cooley, L. Verheyen, E. and Ayers, K. (1992). chickadee encodes a Profilin
required for intercellular cytoplasm transport during Drosophila oogenesis.
Cell 69, 173-184.
Cormack, B. P., Valdivia, R. H. and Falkow, S. (1996). FACS-optimized
mutants of the green fluorescent protein GFP. Gene 173, 33-38.
Dombrádi, V., Axton, J. M., Glover, D. M. and Cohen, P. T. W. (1989).
Cloning and chromosomal localization of Drosophila cDNA encoding the
catalytic subunit of protein phosphatase-1-alpha: high conservation between
mammalian and insect sequences. Eur. J. Biochem. 183, 603-610.
Edgar, B., Sprenger, F., Duronio, R., Leopold, P. and O’Farrell, P. (1994).
Distinct molecular mechanisms regulate cell-cycle timing at successive
stages of Drosophila embryogenesis. Genes Dev. 8, 440-452.
Elfring, L., Axton, J., Fenger, D., Page, A., Carminati, J. and Orr-Weaver,
T. (1997). Drosophila Plutonium protein is a specialized cell cycle regulator
required at the onset of embryogenesis. Mol. Biol. Cell 8, 583-593.
Fenger, D. D., Carminati, J. L., Burney-Sigman, D. L., Kashevsky, H.,
Dines, J. L., Elfring, L. K., Orr-Weaver, T. L (2000). PAN GU: a protein
kinase that inhibits S phase and promotes mitosis in early Drosophila
development. Development 127, 4763-4774.
Frasch, M., Glover, D. M. and Saumweber, H. (1986). Nuclear antigens
follow different pathways into daughter nuclei during mitosis in early
Drosophila embryos. J. Cell Sci. 82, 155-172.
Freeman, M. and Glover, D. (1987). The gnu mutation of Drosophila causes
inappropriate DNA synthesis in unfertilized and fertilized eggs. Genes Dev.
1, 924-930.
Freeman, M., Nüsslein-Volhard, C. and Glover, D. (1986). The dissociation
of nuclear and centrosomal division in gnu, a mutation causing giant nuclei
in Drosophila. Cell 46, 457-468.
Hayles, J. Fisher, D., Woollard, A. and Nurse, P. (1994). Temporal order of
S-phase and mitosis in fission yeast is determined by the state of the p34cdc2
mitotic B-cyclin complex. Cell 78, 813-822.
Heifetz, Y., Yu, J. and Wolfner, M. F. (2001). Ovulation triggers activation
of Drosophila oocytes. Dev. Biol. 234, 416-424.
Huang, J. and Raff, J. (1999). The disappearance of cyclin B at the end
of mitosis is regulated spatially in Drosophila cells. EMBO J. 18, 2184-
2195.
Jang, J. K., Messina, L., Erdman, M. B., Arbel, T. and Hawley, R. S.
(1995). Induction of metaphase arrest in Drosophila oocytes by chiasma-
based kinetochore tension. Science 268, 1917-1919.
Lee, L. A., Elfring, L. K., Bosco, G. and Orr-Weaver, T. L. (2001). A genetic
screen for suppressors and enhancers of the Drosophila PAN GU cell cycle
kinase identifies cyclin B as a target. Genetics 158, 1545-1556.
Lehner, C. F. and O’Farrell, P. H. (1989). Expression and function of
Drosophila cyclin-A during embryonic-cell cycle progression. Cell 56, 957-
968.
Lehner, C. F. and O’Farrell, P. H. (1990).The roles of Drosophila cyclin-A
and cyclin-B in mitotic control. Cell 61, 535-547.
Lilly, M. A. and Spradling, A. C. (1996).The Drosophila endocycle is
controlled by cyclin E and lacks a checkpoint ensuring S-phase completion.
Genes Dev. 10, 2514-2526.
Lindsley, D. L. and Zimm, G. G. (1992). The Genome of Drosophila
melanogaster. London: Academic Press.
Mackintosh, C. and Mackintosh, R. W. (1994). Inhibitors of protein kinases
and phosphatases. Trends Biochem. Sci. 19, 444-448.
Ng, L., Prelich, G., Anderson, C. W., Stillman, B. and Fisher, P. A. (1990)
Drosophila proliferating cell nuclear antigen – structural and functional
homology with its mammalian counterpart. J. Biol. Chem. 265, 11948-
11954.
Page, A. and Orr-Weaver, T. (1996). The Drosophila genes grauzone
and cortex are necessary for proper female meiosis. J. Cell Sci. 109,
1707-1715.
Pellicena-Palle, A., Stitzinger, S. M. and Salz, H. K. (1997). The function
of the Drosophila thioredoxin homologue encoded by the deadhead gene is
A. D. Renault and others
Page 10
3005Gnu regulates mitosis
redox-dependent and blocks the initiation of development but not DNA
synthesis. Mech. Dev. 62, 61-65.
Richardson, H., O’Keefe, L., Reed, S. and Saint, R. (1993). A Drosophila
G1-specific cyclinE homolog exhibits different modes of expression during
embryogenesis. Development 119, 673-690.
Roberts, D. B. and Standen, G. N. (1998). In Drosophila: A Practical
Approach, 2nd edition (ed. D. B. Roberts), pp. 1-54. Oxford: IRL Press.
Rørth, P. (1998). Ga14 in the Drosophila female germline. Mech. Dev. 78,
113-118.
Sagata, N. (1996). Meiotic metaphase arrest in animal oocytes – its
mechanisms and biological significance. Trends Cell Biol. 6, 22-28.
Sambrook, J, Fritsch, E. F. and Maniatis, T. (1989). DNA Cloning,
Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor
Laboratory Press.
Saunders, R. D. C. (1990). Short cuts for genomic walking – chromosome
microdissection and the polymerase chain-reaction. BioEssays 12, 245-
248.
Shamanski, F. and Orr-Weaver, T. (1991). The Drosophila plutonium and
pan gu genes regulate entry into S-phase at fertilization. Cell 66, 1289-1300.
Siden-Kiamos, I., Saunders, R. D. C., Spanos, L., Majerus,T., Treanear,
J., Savakis, C., Louis, C., Glover, D. M., Ashburner, M. and Kafatos, F.
C. (1990). Towards a physical map of the Drosophila melanogaster genome:
mapping of cosmid clones within defined genomic divisions. Nucleic Acids
Res. 18, 6261-6270.
Spradling, A. C. (1986). P-element-mediated transformation. In
Drosophila, A Practical Approach (ed. D. B. Roberts), pp. 175-197.
Oxford: IRL Press.
Su, T., Sprenger, F., DiGregorio, P., Campbell, S. and O’Farrell, P. (1998).
Exit from mitosis in Drosophila syncytial embryos requires proteolysis and
cyclin degradation and is associated with localized dephosphorylation.
Genes Dev. 12, 1495-1503.
Sullivan, W., Ashburner, M. and Hawley, R. S. (2000). Drosophila
Protocols. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Tamkun, J. W., Deuring, R., Scott, M. P., Kissinger, M., Pattatucci, A. M.,
Kaufman, T. C., Kennison, J. A. (1992). Brahma – a regulator of
Drosophila homeotic genes structurally related to the yeast transcriptional
activator Snf2 Sw12. Cell 68, 561-572.
Yamaguchi, M., Hirose, F., Nishida, Y. and Matsukage, A. (1991).
Repression of the Drosophila proliferating-cell nuclear antigen gene
promoter by Zerknullt protein. Mol. Cell. Biol. 11, 4909-4917.
redox-dependent and blocks the initiation of development but not DNA
synthesis. Mech. Dev. 62, 61-65.
Richardson, H., O’Keefe, L., Reed, S. and Saint, R. (1993). A Drosophila
G1-specific cyclinE homolog exhibits different modes of expression during
embryogenesis. Development 119, 673-690.
Roberts, D. B. and Standen, G. N. (1998). In Drosophila: A Practical
Approach, 2nd edition (ed. D. B. Roberts), pp. 1-54. Oxford: IRL Press.
Rørth, P. (1998). Ga14 in the Drosophila female germline. Mech. Dev. 78,
113-118.
Sagata, N. (1996). Meiotic metaphase arrest in animal oocytes – its
mechanisms and biological significance. Trends Cell Biol. 6, 22-28.
Sambrook, J, Fritsch, E. F. and Maniatis, T. (1989). DNA Cloning,
Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor
Laboratory Press.
Saunders, R. D. C. (1990). Short cuts for genomic walking – chromosome
microdissection and the polymerase chain-reaction. BioEssays 12, 245-
248.
Shamanski, F. and Orr-Weaver, T. (1991). The Drosophila plutonium and
pan gu genes regulate entry into S-phase at fertilization. Cell 66, 1289-1300.
Siden-Kiamos, I., Saunders, R. D. C., Spanos, L., Majerus,T., Treanear,
J., Savakis, C., Louis, C., Glover, D. M., Ashburner, M. and Kafatos, F.
C. (1990). Towards a physical map of the Drosophila melanogaster genome:
mapping of cosmid clones within defined genomic divisions. Nucleic Acids
Res. 18, 6261-6270.
Spradling, A. C. (1986). P-element-mediated transformation. In
Drosophila, A Practical Approach (ed. D. B. Roberts), pp. 175-197.
Oxford: IRL Press.
Su, T., Sprenger, F., DiGregorio, P., Campbell, S. and O’Farrell, P. (1998).
Exit from mitosis in Drosophila syncytial embryos requires proteolysis and
cyclin degradation and is associated with localized dephosphorylation.
Genes Dev. 12, 1495-1503.
Sullivan, W., Ashburner, M. and Hawley, R. S. (2000). Drosophila
Protocols. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Tamkun, J. W., Deuring, R., Scott, M. P., Kissinger, M., Pattatucci, A. M.,
Kaufman, T. C., Kennison, J. A. (1992). Brahma – a regulator of
Drosophila homeotic genes structurally related to the yeast transcriptional
activator Snf2 Sw12. Cell 68, 561-572.
Yamaguchi, M., Hirose, F., Nishida, Y. and Matsukage, A. (1991).
Repression of the Drosophila proliferating-cell nuclear antigen gene
promoter by Zerknullt protein. Mol. Cell. Biol. 11, 4909-4917.
Sign up today - FREE
Mendeley saves you time finding and organizing research. Learn more
- All your research in one place
- Add and import papers easily
- Access it anywhere, anytime
Start using Mendeley in seconds!
Readership Statistics
2 Readers on Mendeley
by Discipline
100% Biological Sciences
by Academic Status
50% Senior Lecturer
50% Ph.D. Student
by Country
100% United Kingdom


