Identification and characterization of a Drosophila ortholog of WRN exonuclease that is required to maintain genome integrity
- DOI: 10.1111/j.1474-9726.2008.00388.x
- PubMed: 18346216
Abstract
The premature human aging Werner syndrome (WS) is caused by mutation of the RecQ-family WRN helicase, which is unique in possessing also 3'-5' exonuclease activity. WS patients show significant genomic instability with elevated cancer incidence. WRN is implicated in restraining illegitimate recombination, especially during DNA replication. Here we identify a Drosophila ortholog of the WRN exonuclease encoded by the CG7670 locus. The predicted DmWRNexo protein shows conservation of structural motifs and key catalytic residues with human WRN exonuclease, but entirely lacks a helicase domain. Insertion of a piggyBac element into the 5' UTR of CG7670 severely reduces gene expression. DmWRNexo mutant flies homozygous for this insertional allele of CG7670 are thus severely hypomorphic; although adults show no gross morphological abnormalities, females are sterile. Like human WS cells, we show that the DmWRNexo mutant flies are hypersensitive to the topoisomerase I inhibitor camptothecin. Furthermore, these mutant flies show highly elevated rates of mitotic DNA recombination resulting from excessive reciprocal exchange. This study identifies a novel WRN ortholog in flies and demonstrates an important role for WRN exonuclease in maintaining genome stability.
Author-supplied keywords
Identification and characterization of a Drosophila ortholog of WRN exonuclease that is required to maintain genome integrity
(2008)
7
, pp418–425 Doi: 10.1111/j.1474-9726.2008.00388.x
418
© 2008 The Authors
Journal compilation © Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland 2008
Blackwell Publishing LtdIdentification and characterization of a
Drosophila
ortholog of WRN exonuclease that is required to
maintain genome integrity
Robert D. C. Saunders,
1
Ivan Boubriak,
2
David J. Clancy
1
and Lynne S. Cox
2
1
Department of Biological Sciences, The Open University, Milton
Keynes MK7 6AA, UK
2
Department of Biochemistry, University of Oxford, Oxford OX1
3QU, UK
Summary
The premature human aging Werner syndrome (WS) is
caused by mutation of the RecQ-family WRN helicase,
which is unique in possessing also 3′
–5′
exonuclease activity.
WS patients show significant genomic instability with
elevated cancer incidence. WRN is implicated in restraining
illegitimate recombination, especially during DNA repli-
cation. Here we identify a
Drosophila
ortholog of the
WRN exonuclease encoded by the
CG7670
locus. The
predicted DmWRNexo protein shows conservation of
structural motifs and key catalytic residues with human
WRN exonuclease, but entirely lacks a helicase domain.
Insertion of a piggyBac element into the 5′
UTR of
CG7670
severely reduces gene expression. DmWRNexo mutant
flies homozygous for this insertional allele of
CG7670
are
thus severely hypomorphic; although adults show no
gross morphological abnormalities, females are sterile.
Like human WS cells, we show that the DmWRNexo
mutant flies are hypersensitive to the topoisomerase I
inhibitor camptothecin. Furthermore, these mutant flies
show highly elevated rates of mitotic DNA recombination
resulting from excessive reciprocal exchange. This study
identifies a novel WRN ortholog in flies and demonstrates
an important role for WRN exonuclease in maintaining
genome stability.
Key words: exonuclease;
Drosophila
; genome stability;
homologous recombination; Werner syndrome; WRN.
Introduction
Werner syndrome (WS) provides a very useful model system for
the study of human aging at the molecular level, with patients
manifesting many signs of normal aging in an accelerated
manner (reviewed in Martin, 1985; Goto, 2001; Cox & Faragher,
2007; Kudlow
et
al
., 2007). The syndrome is caused by mutation
of WRN (Yu
et
al
., 1996), a member of the RecQ DNA helicase
family. WS patient-derived cells undergo highly premature
replicative senescence, with cellular defects including aberrant
DNA replication (Pichierri
et
al
., 2001; Rodriguez-Lopez
et
al
.,
2002) and hyper-recombination (Salk
et
al
., 1981; Scappaticci
et
al
., 1982; Fukuchi
et
al
., 1985). Hypersensitivity to the DNA-
damaging agent 4-nitroquinoline oxide, and the topoisomerase
I inhibitor camptothecin (CPT) is characteristic of WS cells (Poot
et
al
., 1999; Prince
et
al
., 1999; Pichierri
et
al
., 2000b). These
agents lead to replication fork arrest or collapse, suggesting a
function for WRN in DNA replication, which is further supported
by its presence at replication foci coincident with RP-A and
PCNA (Constantinou
et
al
., 2000; Rodriguez-Lopez
et
al
., 2003)
and aberrant replication fork progression in WS fibroblasts
(Rodriguez-Lopez
et
al
., 2002). The hyper-recombinant pheno-
type of human WS cells, suppression of illegitimate recombination
in yeast
Sgs1
mutants by human WRN (Yamagata
et
al
., 1998),
interaction with MRN on replication fork stalling (Franchitto &
Pichierri, 2004), the recovery of proliferative capacity after
ectopic expression of a Holliday junction resolvase in WS cells
(Rodriguez-Lopez
et
al
., 2002), and excessive chromosome
breakage at fragile sites in the absence of WRN (Pirzio
et
al
.,
2008) all suggest an important role for WRN in homologous
recombination after replication fork arrest, either in preventing
the formation of homologous recombination intermediates or
in their rapid resolution (Dhillon
et
al
., 2007; Rodriguez-Lopez
et
al
., 2007). The importance of WRN in regulating genome
stability is highlighted by the high cancer incidence in WS
patients, while epigenetic inactivation of WRN is also associated
with human cancer (Agrelo
et
al
., 2006).
Identification of the action of WRN in homologous recombi-
nation is complicated by the presence of two enzymatic activities
within the same protein: the 3
′
–5
′
helicase characteristic of all
RecQ family members (reviewed in Bachrati & Hickson, 2003),
and a 3
′
–5
′
exonuclease activity (Huang
et
al
., 1998) unique
within this family, but which is closely related structurally to
the DnaQ exonuclease superfamily (Perry
et
al
., 2006). X-ray
crystallographic analysis of the exonuclease domain of human
WRN suggests a role in DNA end processing (Perry
et
al
., 2006),
Correspondence
Robert D. C. Saunders, Department of Biological Sciences,
The Open University, Milton Keynes MK7 6AA, UK. Tel. 01908-654069;
fax: 01908-654167; e-mail: r.d.saunders@open.ac.uk
Accepted for publication
7 March 2008
Re-use of this article is permitted in accordance with the Creative Commons
Deed, Attribution 2.5, which does not permit commercial exploitation.
WRN exonuclease maintains genome integrity, R. D. C. Saunders
et al.
© 2008 The Authors
Journal compilation © Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland 2008
419
possibly at the stage of strand resection after double-strand
breaks, such breaks that as occur at collapsed replication forks.
This would be consistent with the importance of WRN in DNA
recombination. However, the closely related BLM helicase can,
at least
in vitro
, promote dissolution of double Holliday junctions
without intrinsic nuclease activity (Wu & Hickson, 2003); deter-
mining the relative contributions to homologous recombination
of the helicase and exonuclease activities of WRN is therefore
important. Moreover, there appears to be a complex interplay
between the helicase and exonuclease activities of WRN
(Opresko
et
al
., 2001); for example, it is possible that helicase
activity may be required to generate a template suitable for
cleavage by the nuclease. The distinct roles are difficult to dis-
sect in vertebrate cells since ablation of one activity may affect
the other; indeed, point mutation of the helicase is suggested
to act in a dominant negative manner (Crabbe
et
al
., 2004).
RNAi depletion of WRN, although highly effective in recapitu-
lating some WS-like phenotypes (Dhillon
et
al
., 2007), eliminates
both helicase and exonuclease activities.
To study WRN’s role in recombination at the organismal level,
we sought to develop a model in which WRN activity may be
evaluated at different developmental stages. Although murine
models have been described which show some WS-like features
on mutation of the WRN helicase alone or with co-mutation of
either telomerase or PARP (Lebel, 2002; Lebel
et
al
., 2003;
Chang
et
al
., 2004; Massip
et
al
., 2006), the relatively long
lifespan and complexity of genetic intervention pose severe
limitations on their exploitation. In order to develop a model
system more amenable to genetic and biochemical analysis of
WRN exonuclease function
in vivo
, we set out to identify and
characterise WRN exonuclease from
Drosophila melanogaster
.
Results
Identification of
Drosophila
WRNexo
We conducted a BLASTP search (Altschul
et
al
., 1997) of the
Drosophila melanogaster
genome sequence (Release 4.0), using
as a probe the sequence of human WRN protein. The
Drosophila
candidate gene encoding a WRN-like exonuclease is
CG7670
,
with an E-value of 1
×
10
–25
(Cox
et
al
., 2007, as also noted by
Sekelsky
et
al
., 2000). Upon cloning from mRNA and sequen-
cing multiple
CG7670
cDNA clones, we found two alleles of
CG7670 differing solely by the presence or absence of an AAG
codon (lysine) at nucleotide 235, amino acid 79 (GenBank accession
numbers EF680279 and EF680280, respectively). Variant 2
(EF680280) lacking lysine 79 was the more commonly occurring
clone, encoding a predicted protein of 352 amino acids.
The predicted protein product of the
CG7670
locus, which
we call DmWRNexo, shares 35% identical and 59% similar
amino acids with the exonuclease domain of human WRN over
a region of 192 residues (Fig. 1A). Previous crystallographic
studies of the human WRN exonuclease domain demonstrated
that residues aspartate (D82) and glutamate (E84) within the
Fig. 1 Homology of DmWRNexo to human WRN.
(A) Alignment of WRN protein sequences from
human, mouse, Xenopus laevis and Arabidopsis
thaliana (AtWEX) with full-length DmWRNexo
(predicted from both our cloned CG7670 cDNA
and genomic sequence (Flybase)). Black depicts
residues identical in three or more species, with
grey showing similarity. Note the highly conserved
blocks of sequence flanking the catalytic core
residues. D82 and E84 metal-ion co-coordinating
residues (residues numbered for the human WRN
protein) are marked with an asterisk. (B) SWISS-
MODEL was used to predict the possible tertiary
structure of DmWRNexo from residues 118–312,
according to the known structure of human WRN
exonuclease (2fbyA, Perry et al., 2006). Left panel
shows the human WRN exonuclease domain while
the right panel shows the predicted structure of
Drosophila melanogaster DmWRNexo.
WRN exonuclease maintains genome integrity, R. D. C. Saunders
et al.
© 2008 The Authors
Journal compilation © Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland 2008
420
nuclease catalytic site are essential for metal ion coordination
(Perry
et
al
., 2006). Importantly, these residues are conserved
in DmWRNexo (Fig. 1A, asterisks). We have conducted SWISS-
MODEL structural predictions (Peitsch, 1996; Schwede
et
al
.,
2003) of DmWRNexo from residues 118–312, which suggest
that the protein might adopt a very similar configuration to
human WRN exonuclease (Perry
et
al
., 2006, PDB accession
number 2fbyA, predicted similarity e-value 8.86
×
10–26), with
conservation of key alpha helices and beta sheets comprising
the nuclease active site (Fig. 1B).
Hypomorphic allele of CG7670
To assess the impact of DmWRNexo mutation on flies, we
obtained an insertional mutant allele of CG7670, CG7670e04496,
which contains a piggyBac{RB} element (Thibault et al., 2004)
inserted within the 5′ UTR (Fig. 2A). Reverse transcription–
polymerase chain reaction (RT-PCR) analysis shows that the
CG7670e04496 allele is transcribed at an extremely low level in
the homozygous mutant compared with CG7670 expression
in heterozygous and wild-type flies (Fig. 2B); no band was
detectable in negative controls (data not shown). Interestingly,
CG7670e04496 homozygotes show no gross morphological
abnormality, and while the females are sterile (eggs do not hatch),
males are fertile. The location of CG7670 on chromosome
3R:14189966.14191859 (Flybase) and its identity with the gene
encoding DmWRNexo is consistent with our mitotic recombination
deficiency mapping studies (mwh1 CG7670e04496/Df(3R)Exel6178
flies display multiple wing hair clones; data not shown).
DmWRNexo mutant flies are hypersensitive to CPT
Werner syndrome cell lines are sensitive to the topoisomerase
I poison CPT (Poot et al., 1999; Pichierri et al., 2000a) which
causes replication fork collapse at the bound topoisomerase
(Shao et al., 1999); such sensitivity can be partially comple-
mented by expression of a bacterial Holliday junction nuclease
(Rodriguez-Lopez et al., 2007), suggesting that WRN acts either
to prevent accumulation of Holliday junctions at collapsed forks
or to ensure rapid Holliday junction resolution. To test whether
Drosophila mutant for DmWRNexo are similarly sensitive to CPT,
larvae derived from crosses of CG7670e04496 heterozygotes were
propagated on medium supplemented with varying concentra-
tions of CPT, or vehicle-only control (0 μM CPT). Emerging flies
were scored for heterozygosity or homozygosity of the
CG7670e04496 allele. While the heterozygous flies appear to be
fully viable at all concentrations of CPT used (Fig. 3), a significant
loss of viability of flies homozygous for the CG7670e04496 allele
(i.e. those with very low levels of expression of DmWRNexo) was
observed even at 0.1 μM CPT, with almost total lethality from
0.2 μM (Fig. 3). Surviving homozygotes displayed roughened
eyes, an indicator of cell death, and many died as pharate adults
(data not shown), a typical lethal phase for flies exhibiting high
levels of cell death. This is consistent with the high levels of
apoptosis detected in human Werner syndrome cells exposed
to CPT (Poot et al., 1999). Thus, loss of DmWRNexo results in
hypersensitivity to CPT.
Genome instability in DmWRNexo mutant flies
Since hyper-recombination is a key phenotype of WS patient-
derived cell lines (Salk et al., 1981; Scappaticci et al., 1982;
Fukuchi et al., 1985), rates of chromosome breakage and/or
mitotic recombination in DmWRNexo homozygous mutant flies
were evaluated using the recessive multiple wing hairs marker
(mwh, recombination map position 3-0.7); wing blade cells
hemizygous or homozygous for mwh1 develop tufts of wing
hairs instead of single hairs. Note that the adult wing consists
of postmitotic cells arising from proliferating cells of the wing
imaginal disc, so any recombination giving rise to clones of
cells with the mwh phenotype must have occurred during cell
proliferation in development.
Wing blades were dissected from flies that were homozygous
mutant for DmWRNexo but heterozygous for mwh (i.e. w1118;
Fig. 2 CG7670e04496 mutant is severely
hypomorphic. (A) The predicted structure of the
CG7670 transcript. The location of the piggyBac
insertion e04496 is indicated. (B) Reverse
transcription–polymerase chain reaction (RT-PCR)
indicates that CG7670 is expressed at very low
levels compared with heterozygotes or wild-type
controls. cDNA was generated by one-step RT-PCR
using primers specific to correctly spliced CG7670
(upper panel) or actin 5C (lower panel), yielding
products of 854 bp (CG7670) and 652 bp (actin).
Lanes 1, 2 CG7670e04496 homozygotes; lanes 3, 4
CG7670e04496 heterozygotes; lanes 5, 6 wild type.
Lanes 1, 3, 5 = male; lanes 2, 4, 6 = female.
© 2008 The Authors
Journal compilation © Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland 2008
421
mwh1 CG7670e04496/CG7670e04496) and analysed microscopically
(Fig. 4A–C). The frequency and size of clones showing multiple
wing hairs was determined (Fig. 4D), demonstrating that mwh
clones occur at a very high frequency in the DmWRNexo
homozygous mutant flies, with an average of over 100 clones
per fly. This is in sharp contrast to flies heterozygous for
DmWRNexo which show a mean of 0.2 mwh clones per fly (data
not shown). Furthermore, some mwh clones in DmWRNexo
homozygous mutant wing blades were very large (> 500 cells)
(Fig. 4D), while the rare clones observed in heterozygous flies
were all single cells (data not shown). In addition to the very
high rates of recombination detected in DmWRNexo mutant
flies, these data also demonstrate that the CG7670e04496 allele
is recessive, as reported for patient-derived human WRN muta-
tions (Yu et al., 1996; Moser et al., 1999).
Cells in the wing blade showing the recessive multiple wing
hairs phenotype could genetically be either homozygous or
hemizygous for the mwh1 allele. Homozygous mwh1 cells would
result from mitotic recombination via a reciprocal exchange
event (Fig. 5A); daughter cells should be euploid without any
loss of proliferative fitness. By contrast, chromosome loss or
single chromosome/chromatid breakage events (Fig. 5B) would
give rise to segmentally aneuploid hemizygous mwh cells, which
would be predicted to proliferate more slowly than euploid cells.
To distinguish between these possibilities, we have measured
the size of each clone in terms of the number of cell cycles since
its generation, and plotted the proportion of clones in each size
class (on a logarithmic scale) against clone size (Fig. 5C). This
type of analysis informs on the nature of the event leading to
clone formation as the gradient of the plot reflects the growth
rate of the clones (Baker et al., 1978). If clones proliferate at
the same rate as surrounding normal cells, the gradient will
closely parallel the expectation (that clones of size class n will
be twice as numerous as clones of size class n + 1). Clones that
proliferate more slowly, as would be expected for segmental
aneuploids, would fit a line of steeper gradient. Our results
(‘Observed’, Fig. 5C) indicate that cells comprising wing blade
clones in DmWRNexo mutant flies proliferate essentially as
Fig. 3 DmWRNexo mutant flies are sensitive to
camptothecin (CPT). Flies heterozygous for the
CG7670e04496 allele were crossed and progeny
reared on medium supplemented with various
concentrations of CPT. The proportion of all
emerging adult flies that were homozygous for
CG7670e04496 was plotted against CPT
concentration; heterozygous flies were fully viable
at all CPT concentrations tested. The lower
frequency of homozygous flies observed at
increasing drug doses demonstrates
hypersensitivity to CPT. n represents the ratio
of CG7670e04496 homozygous: heterozygous flies.
p-values refer to the Fisher exact test for the
probability that the proportion of homozygotes
was less than that of the control value (0 μM CPT).
The error bars show binomial 95% confidence
intervals.
Fig. 4 Hyper-recombination in DmWRNexo mutant flies. (A–C): Wing blades
of flies homozygous for the hypomorphic allele of DmWRNexo (w; mwh1
CG7670e04496/CG7670e04496) were analysed microscopically; mwh clones are
outlined with a broken line. (A) single-cell clone, (B) 10-cell clone, and (C)
moderate-sized clone of mwh cells. (D) Frequency of mwh clones in wing
blades of DmWRNexo homozygous mutant flies (w; mwh1 CG7670e04496/
CG7670e04496) plotted against clone size, i.e. number of cells comprising the
clone (number of clones counted: males n = 1278, females n = 1584). mwh
clones were infrequent (0.2 per fly) in heterozygous controls, and all were
single-cell clones (not shown).
© 2008 The Authors
Journal compilation © Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland 2008
422
expected for euploid cells. However, the gradient is slightly
shallower than expected for two reasons. First, adjacent smaller
clones may have been scored as a single larger clone, and second,
the recombination events happening earlier in the lineage
of the clone (yielding large clones) depletes the pool of cells
from which later events (smaller clones) can occur. The actual
frequency of recombination events occurring may also be higher
than that observed, since sister chromatid exchange is not scored
in this assay. We therefore propose that mitotic recombination
is the predominant cause of mwh clones in these flies. Based
on mathematical simulations (data not shown), we estimate the
recombination frequency on chromosome arm 3L to be at least
0.01 event per cell division. Assuming a similar frequency
throughout the genome, this corresponds to an overall fre-
quency of at least 0.05 recombination events per cell division.
To further distinguish between chromosome breakage and
homologous recombination as the principal mechanism for the
elevated frequency of wing blade clones in CG7670e04496
homozygotes, we used a second cuticular marker, flare (flr,
recombination map position 3–38.8), which causes wing blade
hairs to be malformed. Wing blades of flies mutant for DmWRN-
exo and trans-heterozygous for mwh1 and flr3 (w1118; mwh1
CG7670e04496/flr3 CG7670e04496) were examined for mwh clones
(arising as a consequence of recombination in the chromosomal
interval between mwh and flr) and neighbouring mwh and flr
clones (twin spots), resulting from recombination proximal to
flr (Fig. 6). If the primary mechanism of genome instability in
DmWRNexo mutants is chromosome breakage, mwh flr twin
spots should be rare, while if mitotic recombination is the prin-
cipal cause of wing blade clones, twin spots will be frequent. The
observation of mwh flr twin spots at high frequency (Fig. 6E,F)
strongly suggests that wing blade clones in the DmWRNexo
mutants arise predominantly through mitotic recombination.
Because of the high frequency of recombination in CG7670e04496
homozygotes, numerical analysis of the twin-spot frequency is
difficult and further compounded by sequential repeated
recombination events in clone lineages, as inferred from the
observation of putative mwh flr double mutant cells (Fig. 6E,F).
Fig. 5 Reciprocal exchange is the major
mechanism of mwh clone origin. (A, B)
Recombinational origin of mwh clones. Flies are
initially heterozygous for mwh1 and homozygous
for CG7670e04496. The parental chromosomes
(shown as two sister chromatids linked at the
centromere) are depicted in grey (mwh+) and black
(mwh1); the mwh locus is indicated by a tick mark.
(A) Homologous recombination between mwh
and the centromere gives rise to euploid mwh+/
mwh+ and mwh1/mwh1 daughter cells. (B)
Chromosome breakage between mwh+ and the
centromere gives rise to one euploid mwh1/mwh+
daughter cell of wild-type phenotype (and so not
scored) and one aneuploid daughter cell that is
hemizygous for the mutant mwh1 allele, and
which therefore shows the mwh phenotype.
(C) The proliferation rate of mwh clones supports
mitotic exchange as the principal cause of clone
formation. Logarithmic plot of the frequency of
clones of each clone size class against clone size,
where clone size is expressed in numbers of cell
cycles completed. If recombination results in
euploid cells which proliferate at a normal rate, the
expectation is that clones of size n cell cycles
should be twice as frequent as clones of cell cycle
n + 1. This results in a line indicated as ‘Expected’
(broken line) in the graph. Should the causative
mechanism result in slowly growing cells (for
example, if the marked clones are derived
from aneuploid cells), the distribution of clone
frequencies would tend towards a line of steeper
gradient. The gradient of the observed distribution
(diamonds) corresponds well to the gradient
expected (broken line) for euploid cells (see text
for further details).
© 2008 The Authors
Journal compilation © Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland 2008
423
Nonetheless, it is clear that a significant proportion of wing
blade clones are derived from homologous exchange. This is in
marked contrast to the high rates of chromosomal breakage
and loss observed in flies mutant for the RecQ homolog DmBLM
(mus309) (Kusano et al., 2001). Additionally CG7670e04496
homozygote males are fully fertile, inconsistent with chromo-
somal breakage.
Discussion
We have identified the locus CG7670 as the Drosophila ortholog
of human WRN exonuclease. The encoded DmWRNexo protein
shows significant structural and sequence similarities to human
WRN exonuclease domain, and moreover, a severe hypomorphic
mutation of the locus results in both hyper-recombination
and CPT hypersensitivity in flies, features characteristic of human
WS cells.
Our data demonstrate that loss of DmWRNexo function leads
to very high levels of recombination in the developing Dro-
sophila wing (and presumably also in other dividing tissues),
consistent with hyper-recombination reported in cells from WS
patients (Salk et al., 1981; Scappaticci et al., 1982; Fukuchi
et al., 1985). The high frequency of twin spots in wing blade
clones seen here strongly supports the assertion that the
majority of marked clones in the mutant flies arise as a result of
homologous recombination rather than chromosomal break-
age. We cannot at this stage rule out the possibility that non-
homologous end joining is also aberrant, as is the case in human
cells lacking functional WRN (Chen et al., 2003; Otsuki et al.,
2007), since such end joining is unlikely to yield scoreable clones
in the assays used here.
Mechanistically, it has been difficult to differentiate between
the impact of the exonuclease and helicase activities of WRN
in vivo since RNAi ablates all activities, while point mutants may
act as dominant negatives (Crabbe et al., 2004). By studying a
model organism in which the WRN exonuclease activity is
encoded on a genomic locus distinct from any putative partner
helicase, we can readily ablate the exonuclease activity without
the possibility of creating dominant negative complexes. Our
data presented here clearly demonstrate the importance of
WRN exonuclease in restraining mitotic recombination. Further-
more, it is likely that at least some of the recombination
detected in the DmWRNexo mutants occurs as a result of defi-
ciencies in resolving aberrant DNA structures arising during DNA
replication. The observed hypersensitivity of CG7670e04496
homozygotes to CPT is indicative of a role for DmWRNexo at
collapsed replication forks, as predicted from human studies
(Pichierri et al., 2001; Rodriguez-Lopez et al., 2002, 2007; Pirzio
et al., 2008). Human WRN can regress replication forks in vitro
(Machwe et al., 2006); how it supports re-establishment of
collapsed forks in vivo is less clear, but our data suggest that
the exonuclease activity of WRN may be important in preventing
hyper-recombination at this stage. We speculate that DmWRN-
exo, like human WRN (Saintigny et al., 2002; Dhillon et al., 2007;
Rodriguez-Lopez et al., 2007), may act to prevent Holliday junc-
tion accumulation at stalled or collapsed replication forks, and
that DNA end processing activity of the exonuclease (Perry et al.,
2006) may be critical to direct fork re-establishment. Such end
processing could result in removal of DNA strands that would
otherwise be used in the strand invasion step in homologous
recombination. Thus, in cells lacking DmWRNexo, collapsed
replication forks (such as at CPT-induced breaks) would persist,
and promote Holliday junction formation and homologous
recombination.
This study demonstrates the strength of using a genetically
amenable model system for analysis of genes associated with
genomic instability and human aging, even though the adult is
largely postmitotic; absence of DmWRNexo function through
fly development manifests as a hyper-recombinant phenotype
in the mature adult. This raises the exciting possibility of using
the short-lived fruit fly as model system for analysis and experi-
mental modulation of WRN function in vivo.
Fig. 6 Twin-spot analysis confirms that hyper-recombination occurs through
reciprocal exchange. (A) Position of mwh1 and flr3 markers relative to the
centromere and CG7670 locus on chromosome 3 (not to scale). (B–F) Wing
blade twin-spot mwh flr clones were analysed microscopically. mwh clones
are outlined with red broken lines and flr clones by blue broken lines.
(B, C) mwh-flr twin spots resulting from recombination proximal to flr
(within interval (b) in diagram). (D–F) complex clones indicating sequential
recombination events. Arrows in (E), (F) and the inset in (E) indicate a possible
mwh flr double mutant cell.
© 2008 The Authors
Journal compilation © Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland 2008
424
Experimental procedures
Bioinformatics
BLAST searches (Altschul et al., 1997) were conducted against
Release 4.0 of the Drosophila melanogaster genome sequence,
and reciprocally against the human protein RefSeq database.
BioEdit was used to generate the alignments following process-
ing with Clustal W. Structural predictions were carried out using
SWISS-MODEL (Peitsch, 1996; Schwede et al., 2003) based on
the structure of human WRN exonuclease domain (Perry et al.,
2006).
DNA and RNA analysis
Total RNA was extracted from flies using RNeasy spin columns
(Qiagen, Crawley, West Sussex, UK) and quantitated using a Qubit
fluorometer (Invitrogen, Paisley, UK). For analysis of transcript
levels, one-step RT-PCR (Qiagen) was carried out with gene-specific
primers (CG7670 Exon1–2 F: 5′-ATGAAGTTCCCAAGGAAGAGG-
3′; CG7670 Exon1–2 R: 5′-GATGGCGGCGTACATTAGTT-3′; actin
5C F: 5′-CACCGGTATCGTTCTGGACT-3′, actin 5C R: 5′-GGACT-
CGTCGTACTCCTGCT-3′) using 0.5 μg total RNA. Products were
analysed on 0.9% agarose gels stained with ethidium bromide,
against a 100-bp ladder (Roche, Burgess Hill, West Sussex, UK).
To clone CG7670, cDNA was prepared from freshly isolated
RNA from female flies (TM6B/TM3, wild type for CG7670) using
Omniscript reverse transcriptase (Qiagen) and random hexamer
primers (Operon, Cologne, Germany) or oligo-dt(16) primers
(Applied Biosystems, Warrington, UK). The cDNA was PCR-
amplified using pfx50 proofreading DNA polymerase (Invitro-
gen) and primers Forward F1A (CGGGTTATGGAAAAATATT-
TAACAAAAATGCCC) and Reverse R-2 A
(AGCTTACAGAGTCACCTCGTTGATCTTGG), to yield a blunt-
end PCR product which was cloned into TOPO vector (Zero
Blunt®TOPO® PCR Cloning Kit, Invitrogen). DNA sequencing was
performed in-house by Geneservice on an ABI 3730xl DNA Analyser.
Fly stocks
Fly stocks were obtained from the Bloomington Drosophila
Stock Center (http://flystocks.bio.indiana.edu/), and were main-
tained on a standard oatmeal, yeast, molasses and agar
medium. Wing blades were dissected from flies stored in 70%
ethanol, mounted in Gary’s Magic Mountant (Lawrence et al.,
1986) and analysed by brightfield microscopy.
Camptothecin sensitivity studies
Fly medium containing 60 g L–1 each of dextrose and yeast, 3%
w/v nipagin and 3% v/v propionic acid was supplemented with
CPT in a 5% ethanol/5% Tween-20 solution to achieve final CPT
concentrations of 0–0.8 μM in vials containing 10 mL fly food
(Cunhe et al., 2002). Heterozygous CG7670e04496/TM6B flies
were crossed and eggs were seeded into 4–5 vials per dose at
~200 eggs/vial, according to Clancy & Kennington (2001) and
allowed to develop at 18 °C. Surviving heterozygous and
homozygous adult flies were scored.
Acknowledgments
We thank Christine Borer for technical support. We are grateful
to the BBSRC for funding this research. I.B. is supported by
grant no. BB/E000924/1 to L.S.C.; D.J.C. is supported by
grant no. BB/E002072/1 to R.D.C.S.
References
Agrelo R, Cheng WH, Setien F, Ropero S, Espada J, Fraga MF, Herranz M,
Paz MF, Sanchez-Cespedes M, Artiga MJ, Guerrero D, Castells A,
von Kobbe C, Bohr VA, Esteller M (2006) Epigenetic inactivation of
the premature aging Werner syndrome gene in human cancer. Proc.
Natl Acad. Sci. USA 103, 8822–8827.
Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman
DJ (1997) Gapped BLAST and PSI-BLAST: a new generation of protein
database search programs. Nucleic Acids Res. 25, 3389–3402.
Bachrati CZ, Hickson ID (2003) RecQ helicases: suppressors of tumori-
genesis and premature aging. Biochem. J. 374, 577–606.
Baker BS, Carpenter AT, Ripoll P (1978) The utilization during mitotic
cell division of loci controlling meiotic recombination and disjunction
in Drosophila melanogaster. Genetics 90, 531–578.
Chang S, Multani AS, Cabrera NG, Naylor ML, Laud P, Lombard D,
Pathak S, Guarente L, DePinho RA (2004) Essential role of limiting
telomeres in the pathogenesis of Werner syndrome. Nat. Genet. 36,
877–882.
Chen L, Huang S, Lee L, Davalos A, Schiestl RH, Campisi J, Oshima J
(2003) WRN, the protein deficient in Werner syndrome, plays a critical
structural role in optimizing DNA repair. Aging Cell 2, 191–199.
Clancy DJ, Kennington WJ (2001) A simple method to achieve consistent
larval density in bottle cultures. Drosoph. Inf. Serv. 84, 168–169.
Constantinou A, Tarsounas M, Karow JK, Brosh RM, Bohr VA, Hickson ID,
West SC (2000) Werner’s syndrome protein (WRN) migrates Holliday
junctions and co-localizes with RPA upon replication arrest. EMBO
Rep. 1, 80–84.
Cox LS, Faragher RGA (2007) From old organisms to new molecules:
integrative biology and therapeutic targets in accelerated human ageing.
Cell Mol. Life Sci. 64, 2620–2641.
Cox LS, Clancy DJ, Boubriak I, Saunders RD (2007) Modeling Werner
syndrome in Drosophila melanogaster: hyper-recombination in flies
lacking WRN-like exonuclease. Ann. N Y Acad. Sci. 1119, 274–288.
Crabbe L, Verdun RE, Haggblom CI, Karlseder J (2004) Defective telomere
lagging strand synthesis in cells lacking WRN helicase activity. Science
306, 1951–1953.
Cunha KS, Reguly ML, Graf U, Rodrigues de Andrade HH (2002)
Comparison of camptothecin derivatives presently in clinical trials:
genotoxic potency and mitotic recombination. Mutagenesis 17, 141–
147.
Dhillon KK, Sidorova J, Saintigny Y, Poot M, Gollahon K, Rabinovitch
PS, Monnat RJ Jr (2007) Functional role of the Werner syndrome RecQ
helicase in human fibroblasts. Aging Cell 6, 53–61.
Franchitto A, Pichierri P (2004) Werner syndrome protein and the MRE11
complex are involved in a common pathway of replication fork recovery.
Cell Cycle 3, 1331–1339.
Fukuchi K, Tanaka K, Nakura J, Kumahara Y, Uchida T, Okada Y (1985)
Elevated spontaneous mutation rate in SV40–transformed Werner
syndrome fibroblast cell lines. Somat Cell Mol. Genet. 11, 303–308.
© 2008 The Authors
Journal compilation © Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland 2008
425
Goto M (2001) Clinical characteristics of Werner syndrome and other
premature aging syndromes: pattern of aging in progeroid syn-
dromes. In From Premature Gray Hair to Helicase – Werner Syndrome:
Implications for Aging and Cancer (Goto M, Miller RW, eds). Tokyo,
Japan: Japan Scientific Societies Press, pp. 27–39.
Huang S, Li B, Gray MD, Oshima J, Mian IS, Campisi J (1998) The
premature ageing syndrome protein, WRN, is a-3′–5′ exonuclease.
Nat. Genet. 20, 114–116.
Kudlow BA, Kennedy BK, Monnat RJ Jr (2007) Werner and Hutchinson–
Gilford progeria syndromes: mechanistic basis of human progeroid
diseases. Nat. Rev. Mol. Cell Biol. 8, 394–404.
Kusano K, Johnson-Schlitz DM, Engels WR (2001) Sterility of Drosophila
with mutations in the Bloom syndrome gene – complementation by
Ku70. Science 291, 2600–2602.
Lawrence PA, Johnston P, Morata G (1986) Methods of marking cells.
In Drosophila: A Practical Approach (Roberts, DB, ed.). Oxford, UK:
IRL Press, pp. 229–242.
Lebel M (2002) Increased frequency of DNA deletions in pink-eyed unstable
mice carrying a mutation in the Werner syndrome gene homologue.
Carcinogenesis 23, 213–216.
Lebel M, Lavoie J, Gaudreault I, Bronsard M, Drouin R (2003) Genetic
cooperation between the Werner syndrome protein and poly(ADP-
ribose) polymerase-1 in preventing chromatid breaks, complex chro-
mosomal rearrangements, and cancer in mice. Am. J. Pathol. 162,
1559–1569.
Machwe A, Xiao L, Groden J, Orren DK (2006) The Werner and Bloom
syndrome proteins catalyze regression of a model replication fork.
Biochemistry 45, 13939–13946.
Martin GM (1985) Genetics and aging: the Werner syndrome as a
segmental progeroid syndrome. Adv. Exp. Med. Biol. 190, 161–170.
Massip L, Garand C, Turaga RV, Deschenes F, Thorin E, Lebel M (2006)
Increased insulin, triglycerides, reactive oxygen species, and cardiac
fibrosis in mice with a mutation in the helicase domain of the Werner
syndrome gene homologue. Exp. Gerontol. 41, 157–168.
Moser MJ, Oshima J, Monnat RJ Jr (1999) WRN mutations in Werner
syndrome. Hum. Mutat 13, 271–279.
Opresko PL, Laine JP, Brosh RM Jr, Seidman MM, Bohr VA (2001) Coordinate
action of the helicase and 3′ to 5′ exonuclease of Werner syndrome
protein. J. Biol. Chem. 276, 44677–44687.
Otsuki M, Seki M, Kawabe Y, Inoue E, Dong YP, Abe T, Kato G,
Yoshimura A, Tada S, Enomoto T (2007) WRN counteracts the
NHEJ pathway upon camptothecin exposure. Biochem. Biophys. Res.
Commun. 355, 477–482.
Peitsch MC (1996) ProMod and Swiss-Model: Internet-based tools for
automated comparative protein modelling. Biochem. Soc. Trans. 24,
274–279.
Perry JJ, Yannone SM, Holden LG, Hitomi C, Asaithamby A, Han S,
Cooper PK, Chen DJ, Tainer JA (2006) WRN exonuclease structure and
molecular mechanism imply an editing role in DNA end processing.
Nat. Struct. Mol. Biol. 13, 414–422.
Pichierri P, Franchitto A, Mosesso P, Palitti F (2000a) Werner’s syndrome
cell lines are hypersensitive to camptothecin-induced chromosomal
damage. Mutat. Res. 456, 45–57.
Pichierri P, Franchitto A, Mosesso P, Proietti de Santis L, Balajee AS, Palitti
F (2000b) Werner’s syndrome lymphoblastoid cells are hypersensitive
to topoisomerase II inhibitors in the G2 phase of the cell cycle. Mutat.
Res. 459, 123–133.
Pichierri P, Franchitto A, Mosesso P, Palitti F (2001) Werner’s syndrome
protein is required for correct recovery after replication arrest and DNA
damage induced in S-phase of cell cycle. Mol. Biol. Cell 12, 2412–2421.
Pirzio LM, Pichierri P, Bignami M, Franchitto A (2008) Werner syndrome
helicase activity is essential in maintaining fragile site stability. J. Cell
Biol. 180, 305–314.
Poot M, Gollahon KA, Rabinovitch PS (1999) Werner syndrome lym-
phoblastoid cells are sensitive to camptothecin-induced apoptosis in
S-phase. Hum. Genet. 104, 10–14.
Prince PR, Ogburn CE, Moser MJ, Emond MJ, Martin GM, Monnat RJ
Jr (1999) Cell fusion corrects the 4-nitroquinoline 1-oxide sensitivity
of Werner syndrome fibroblast cell lines. Hum. Genet. 105, 132–
138.
Rodriguez-Lopez AM, Jackson DA, Iborra F, Cox LS (2002) Asymmetry
of DNA replication fork progression in Werner’s syndrome. Aging Cell
1, 30–39.
Rodriguez-Lopez AM, Jackson DA, Nehlin JO, Iborra F, Warren AV,
Cox LS (2003) Characterisation of the interaction between WRN,
the helicase/exonuclease defective in progeroid Werner’s syn-
drome, and an essential replication factor, PCNA. Mech. Ageing Dev.
124, 167–174.
Rodriguez-Lopez AM, Whitby MC, Borer CM, Bachler MA, Cox LS (2007)
Correction of proliferation and drug sensitivity defects in the progeroid
Werner’s syndrome by Holliday junction resolution. Rejuvenation Res.
10, 27–40.
Saintigny Y, Makienko K, Swanson C, Emond MJ, Monnat RJ Jr (2002)
Homologous recombination resolution defect in werner syndrome.
Mol. Cell Biol. 22, 6971–6978.
Salk D, Au K, Hoehn H, Martin GM (1981) Cytogenetics of Werner’s
syndrome cultured skin fibroblasts: variegated translocation mosaicism.
Cytogenet Cell Genet. 30, 92–107.
Scappaticci S, Cerimele D, Fraccaro M (1982) Clonal structural chromosomal
rearrangements in primary fibroblast cultures and in lymphocytes of
patients with Werner’s Syndrome. Hum. Genet. 62, 16–24.
Schwede T, Kopp J, Guex N, Peitsch MC (2003) SWISS-MODEL: an auto-
mated protein homology-modeling server. Nucleic Acids Res. 31,
3381–3385.
Sekelsky JJ, Brodsky MH, Burtis KC (2000) DNA repair in Drosophila:
insights from the Drosophila genome sequence. J. Cell Biol. 150, F31–
F36.
Shao RG, Cao CX, Zhang H, Kohn KW, Wold MS, Pommier Y (1999)
Replication-mediated DNA damage by camptothecin induces phos-
phorylation of RPA by DNA-dependent protein kinase and dissociates
RPA:DNA-PK complexes. EMBO J. 18, 1397–1406.
Thibault ST, Singer MA, Miyazaki WY, Milash B, Dompe NA, Singh CM,
Buchholz R, Demsky M, Fawcett R, Francis-Lang HL, Ryner L, Cheung
LM, Chong A, Erickson C, Fisher WW, Greer K, Hartouni SR, Howie
E, Jakkula L, Joo D, Killpack K, Laufer A, Mazzotta J, Smith RD, Stevens
LM, Stuber C, Tan LR, Ventura R, Woo A, Zakrajsek I, Zhao L, Chen
F, Swimmer C, Kopczynski C, Duyk G, Winberg ML, Margolis J (2004)
A complementary transposon tool kit for Drosophila melanogaster
using P and piggyBac. Nat. Genet. 36, 283–287.
Wu L, Hickson ID (2003) The bloom’s syndrome helicase suppresses
crossing over during homologous recombination. Nature 426, 870–
874.
Yamagata K, Kato J, Shimamoto A, Goto M, Furuichi Y, Ikeda H (1998)
Bloom’s and Werner’s syndrome genes suppress hyperrecombination
in yeast sgs1 mutant: implication for genomic instability in human dis-
eases. Proc. Natl Acad. Sci. USA 95, 8733–8738.
Yu CE, Oshima J, Fu YH, Wijsman EM, Hisama F, Alisch R, Matthews S,
Nakura J, Miki T, Ouais S, Martin GM, Mulligan J, Schellenberg GD
(1996) Positional cloning of the Werner’s syndrome gene. Science
272, 258–262.
Sign up today - FREE
Mendeley saves you time finding and organizing research. Learn more
- All your research in one place
- Add and import papers easily
- Access it anywhere, anytime



