Molecular Ecology Resources (2008) 8, 1114–1116 doi: 10.1111/j.1755-0998.2008.02175.x
© 2008 The Authors
Journal compilation © 2008 Blackwell Publishing Ltd
Blackwell Publishing LtdPERMANENT GENETIC RESOURCES
Isolation and characterization of microsatellite loci in
Epidendrum puniceoluteum, an endemic orchid from
the Atlantic Rainforest
F. PINHEIRO,*,†† M. O. SANTOS,†‡ C . PALMA-SILVA,§ F. BARROS,¶ D. MEYER,** A. SALATINO,*
A. P. SOUZA†‡ and S . COZZOLINO††
*Departamento de Botânica, IB/USP, 05508-900 São Paulo, SP, Brazil, †Departamento de Genética e Evolução, IB/UNICAMP,
13083-970 Campinas, SP, Brazil, ‡Centro de Biologia Molecular e Engenharia Genética (CBMEG), UNICAMP, 13083-970 Campinas,
SP, Brazil, §Departamento de Genética, IB/UFRGS, 91501-970 Porto Alegre, RS, Brazil, ¶Instituto de Botânica, Seção de Curadoria do
Herbário, 04301-012 São Paulo, SP, Brazil, **Departamento de Genética e Biologia Evolutiva, IB/USP, 05508-900 São Paulo, SP, Brazil,
††Dipartimento delle Scienze Biologiche, Università degli Studi Federico II, I-80139 Napoli, Italy
Abstract
Epidendrum puniceoluteum is an endemic orchid of Atlantic Rainforest, restricted to few
populations only due to the destruction and fragmentation of its native habitat. Here, we
report on the development of 10 microsatellite markers isolated from this orchid species.
Genetic variability was characterized in two distant populations from Brazil coast. The number
of alleles observed for each locus ranged from two to 12 and with an average of 6.4 alleles
per locus. These microsatellites should be valuable tools for studying both fine-scale genetic
structure of scattered E. puniceoluteum population and patterns will be useful genetic markers
for other closely related taxa.
Keywords: Atlantic Rainforest, cross-amplification, Epidendrum, microsatellites, Orchidaceae
Received 10 December 2007; revision accepted 12 February 2008
The fragmentation of the Atlantic Rainforest, a worldwide
biodiversity hotspot, represents a dramatic process with a
strong impact on genetic diversity of local plant community
(Cardoso et al. 2005). Knowledge about demographic events
that shape the genetic patterns in fragmented populations
can help conservation efforts to preserve threatened species.
Among the several Neotropic orchids of the Atlantic
Rainforest, Epidendrum is the largest genus showing great
morphological diversity that has recently generated many
taxonomic doubts about its generic classification and species
delimitation (Hágsater 1984). Epidendrum puniceoluteum is a
recently described orchid species (Pinheiro & Barros 2006)
that had a wide distribution in the past, from São Paulo and
Rio Grande do Sul States, Brazil, but is now restricted to few
populations only due to the destruction of its native habitat.
Here, we report on the development of a set of polymorphic
microsatellite [simple sequence repeat (SSR)] markers for
E. puniceoluteum that will be useful in addressing questions
on the genetic structure of this endangered species.
Total genomic DNA was extracted from silica gel-exsiccated
leaves of E. puniceoluteum following the protocol of Doyle
& Doyle (1990). Markers isolation involved the construction
of a genomic library partially enriched for (CT)n and (GT)n
repeats by using biotinylated oligonucleotide sequences
bound to streptavidin-coated magnetic particles as described
by Kijas et al. (1994) with modifications by Billote et al. (1999).
Microsatellite-enriched DNA fragments were ligated into
pGEM-T Easy vector (Promega) as described by the supplier
and used to transform XL1-Blue competent Escherichia coli
cells (Stratagene). A total of 96 recombinant colonies were
obtained and sequenced using the BigDye version 3.1
terminator kit on the ABI PRISM 3130 Sequence Analyser
(Applied Biosystems). For 21 clones, containing SSR motifs,
forward and reverse sequences were aligned in seqman
(DNASTAR package), and primers were designed for 14
loci using the primer 3 software (http://frodo.wi.mit.edu/
cgi-bin/primer3/primer3_www.cgi).
Correspondence: Fabio Pinheiro, Instituto de Biociências, Univer-
sidade de São Paulo, Departamento de Botânica, Rua do Matão
277, 05508–900, São Paulo, SP, Brazil. Fax: +55 113091 7547; E-mail:
biopinheiro@yahoo.com.br

P E R M A N E N T G E N E T I C R E S O U R C E S 1115
© 2008 The Authors
Journal compilation © 2008 Blackwell Publishing Ltd
For each SSR, the forward primers were synthesized with a
19-bp long 5′ M13 tail (5′-CACGACGTTGTAAAACGAC-3′)
following the amplification method of Schuelke (2000). All
polymerase chain reaction (PCR) amplifications were
performed in an Applied Biosystems 2700 thermocycler in
10-μL reactions containing: 10 ng template, 1× PCR buffer
(Amersham Pharmacia Biotech), 2 mm MgCl2, 100 μm dNTPs,
1 pmol forward primer, 4 pmol reverse primer, 0.4 pmol
label (6-FAM or JOE: Applied Biosystems) M13 primer and
0.5 U Taq polymerase (Amersham Pharmacia Biotech). A
‘touchdown’ cycling programme was used: 95 °C for 3 min,
then 10 cycles of 94 °C for 30 s, 58 °C decreasing to 48 °C at
1 °C per cycle for 30 s, 72 °C for 30 s followed by 40 cycles
of 94 °C for 30 s, 48 °C for 30 s, 72 °C for 30 s, followed by a
final extension of 20 min at 72 °C. PCR products were resolved
on a 3130 DNA Sequence Analyser and were sized with
Genescan 500 LIZ size standard using genemapper version
3.7 software (Applied Biosystems).
A total of 40 individuals from two Brazilian populations
of E. puniceoluteum (Imbituba and Pontal do Paraná) were
analysed to evaluate SSR polymorphism. arlequin 3.11
(Excoffier et al. 2005) software was used to calculate observed
and expected heterozygosities, and to test for departure from
Hardy–Weinberg equilibrium and for linkage disequilibrium
between all pairs of loci. Ten SSRs were polymorphic,
with the number of observed alleles per locus ranging
from two to 12 with an average of 6.4 alleles per locus. The
observed heterozygosity for the polymorphic loci ranged
between zero and 0.95 with an average of 0.377 (Table 1).
We found an absence of polymorphism at locus EPP49
in the Imbituba population. In the same population, two
loci (EPP8 and EPP17) showed a significant departure
from Hardy–Weinberg equilibrium (P < 0.001), due to
heterozygote deficiency. The small size of the Imbituba
population and fragmentation history of the region may be
causing the observed low levels of diversity and the Hardy–
Weinberg disequilibrium for some loci in this population.
No linkage disequilibrium between any pair of loci was
detected.
The primers proved to be useful in revealing levels of
diversity in both populations and thus can be used to explore
the genetic structure of fragmented populations of E. puni-
ceoluteum across its actual geographical range. Historical
demographic patterns such as bottlenecks and range
contraction will be compared with information on repro-
ductive success and seed dispersal ability in order to
identify the evolutionary processes that are shaping their
actual genetic patterns of populations.
Table 1 Characteristics of microsatellite loci from Epidendrum puniceoluteum, including locus name, primer sequences, repeat type
(interrupted microsatellites are indicated by a ( ... ) between repeats), no. of alleles (A), allele size range, observed (HO) and expected (HE)
heterozygosity for each population, and the significance of the test for departure from Hardy–Weinberg equilibrium (HWE). Locus EPP49
was monomorphic for Imbituba population. GenBank Accession nos EU326290–EU326299
Locus Primer sequences† Repeat A
Size range
(bp)
Pontal Imbituba
HO HE HO HE
EPP08 F: TGTTCAAGAACAACATCGGACT (GA)9 3 219–223 0.100 0.184 0 0.405*
R: TCTTGCTGGTTGGCATTATCT
EPP10 F: GGAGGCCAATGTGATGAAAC (GT)5 ... (AG)9 ... (AG)25 6 234–250 0.350 0.344 0.400 0.478
R: TCGAATAAGCTCCTGCATCC
EPP12 F: GTCGGTGAGGGTCCAGAAA (GA)21 9 177–197 0.600 0.715 0.400 0.457
R: CACCATCTTCTCTCCCCTGAG
EPP17 F: AGCACATCCGGGCCTAACTA (TC)13T(TC)9 10 203–223 0.700 0.750 0.250 0.708*
R: TGCCTGGCATCCATAATGAC
EPP18 F: TGCATACGTAACAACTGGAGGT (AG)24 12 288–324 0.350 0.321 0.400 0.503
R: GGAAGGTCATTCTAACCAGGAA
EPP49 F: GCAAAGGGAGACGATTTGAG (GA)17 2 182–186 0.150 0.142 mono mono
R: AGCATTTTTCGCCCTTAACA
EPP56 F: ACGCTCTTTGGCTGGAACT (TC)16 2 136–144 0.150 0.142 0.300 0.492
R: CTCACATGCCTTTAGCCTCAC
EPP86 F: CAGCCTTTAGGCATTCTTGG (GA)14 11 215–239 0.550 0.650 0.950 0.846
R: GCTCATTGGCCTTAGTGACC
EPP89 F: TTCTTGTTGTCGCCTTCGAT (GA)3AA(GA)3 ... (GA)10
GG(GA)5
4 284–290 0.300 0.328 0.350 0.314
R: TCAGAGAGCTCGTCCGACA
EPP96 F: TCTAACATGCGAAGGCAAAA (AG)12 5 291–299 0.650 0.544 0.600 0.635
R: TTTGGTTGTTAAGCCCCATT
†All forward primers were M13-tailed at the 5′ end. Significant departures from HWE: *P < 0.001.

1116 P E R M A N E N T G E N E T I C R E S O U R C E S
© 2008 The Authors
Journal compilation © 2008 Blackwell Publishing Ltd
Cross-species and cross-genera amplification of the
microsatellite primers were performed on Epidendrum
species and related members from subtribe Laeliinae
(Table 2). Amplification was performed on single individual
of each tested species using the same amplification conditions
used for E. puniceoluteum. Several positive amplifications
of PCR products with the expected allele sizes occurred
across all tested species. These primers therefore should be
useful for population studies both in E. puniceoluteum and in
related species and genera, contributing to the knowledge
about diversification processes and conservation in South
American orchids.
Acknowledgements
We thank V. Tranchida Lombardo, R. Rinaldi, F. Monteiro, R.C.
Winkworth, M.M.S. Ferreira and J. Lovo for technical support and
helpful discussions on this manuscript. This work was supported
by grants from FAPESP (06/54189-3) and CNPq (471929/2006-9)
to F.P. and F.B., and by awards from CAPES to F.P. and CNPQ to
F.P., F.B., A.S. and A.P.S.
References
Billote N, Risterucci A-M, Baurens F-C (1999) Microsatellite
enriched libraries: applied methodology for the development of
SSR markers in tropical crops. Fruits, 54, 277–288.
Cardoso SRS, Provan J, Lira CCD, Pereira LDR, Ferreira PCG,
Cardoso MA (2005) High levels of genetic structuring as a result
of population fragmentation in the tropical tree species Caes-
alpinia echinata Lam. Biodiversity and Conservation, 14, 1047–1057.
Doyle JJ, Doyle JL (1990) Isolation of plant DNA from fresh tissue.
Focus, 12, 13–15.
Excoffier L, Laval LG, Schneider S (2005) arlequin, Version 3.0: an
integrated software package for population genetics data
analysis. Evolutionary Bioinformatics Online, 1, 47–50.
Hágsater E (1984) Towards an understanding of the genus
Epidendrum. In: Proceedings of the 11th World Orchid Conference
(ed. Tan KW) World Orchid Conference Inc., Miami, Florida.
Kijas JM, Fowler JC, Garbett CA, Thomas MR (1994) Enrichment
of microsatellites from the citrus genome using biotinylated
oligonucleotide sequences bound to streptavidin-coated
magnetic particles. BioTechniques, 16, 656–660.
Pinheiro F, Barros F (2006) Epidendrum puniceoluteum, uma nova
espécie de Orchidaceae do litoral brasileiro. Hoehnea, 33, 247–250.
Schuelke M (2000) An economic method for the fluorescent labelling
of PCR fragments. Nature Biotechnology, 18, 233–234.
Table 2 Cross-species and genera amplification of 10 microsatellite primers from Epidendrum puniceoluteum within the subtribe Laeliinae.
Successful amplification with a single band visualized with expected allele size (+), successful amplification with more than one band
visualized, with at least one band with the expected allele size (++), weak amplification of a band with the expected allele size (W) and failed
amplification (–) are indicated
Species EPP8 EPP10 EPP12 EPP17 EPP18 EPP49 EPP56 EPP86 EPP89 EPP96
Epidendrum xanthinum + W + + + + ++ ++ + +
Epidendrum secundum + W + – ++ ++ ++ + + +
Pseudolaelia cipoensis + – + + W + – ++ + W
Cattleya eldorado W – W – W + + + + W
Prosthechea vespa + – + – + + + ++ + + W