Sign up & Download
Sign in

Microsatellites from rubber tree (Hevea brasiliensis) for genetic diversity analysis and cross-amplification in six Hevea wild species

by L M Souza, C C Mantello, M O Santos, P Souza Gonçalves, Anete Pereira Souza
Conservation Genetics Resources (2009)

Cite this document (BETA)

Available from www.springerlink.com
Page 1
hidden

Microsatellites from rubber tree (Hevea brasiliensis) for genetic diversity analysis and cross-amplification in six Hevea wild species

TECHNICAL NOTE
Microsatellites from rubber tree (Hevea brasiliensis) for genetic
diversity analysis and cross-amplification in six Hevea wild species
L. M. Souza Æ C. C. Mantello Æ M. O. Santos Æ
P. de Souza Gonc¸alves Æ Anete Pereira Souza
Received: 29 April 2009 / Accepted: 6 May 2009 / Published online: 29 May 2009
 Springer Science+Business Media B.V. 2009
Abstract Hevea brasiliensis is native to the Amazonian
rain forest and an important source of natural rubber.
Twenty seven polymorphic microsatellite loci were iso-
lated and characterized from a GA–CA enriched genomic
library of H. brasiliensis. The number of alleles ranged
from 2 to 20. The observed and expected heterozygosity
ranged from 0.13 to 0.88 and from 0.00 to 0.89, respec-
tively. Cross-species amplification of the markers devel-
oped for H. brasiliensis was successful in the wild Hevea
species H. guianensis, H. rigidifolia, H. nitida, H. pau-
ciflora, H. benthamiana and H. camargoana. The data
indicated a high degree of sequence homology in the
microsatellite flanking regions of these species. The
developed SSR loci are a potential powerful tool for studies
of population genetics, genetic diversity and gene flow
among Hevea species.
Keywords Hevea spp.  Hevea brasiliensis 
Microsatellite  Genetic diversity  Transferability 
Cross-species amplification
Hevea brasiliensis is native to the Amazonian rainforest.
The genus Hevea belongs to the Euphorbiaceae family and
comprises 11 inter-crossable species (Pires et al. 2002),
which have evolved in the Amazonian rainforest over 100
thousand years ago (Clement-Demange et al. 2000). The
species H. brasiliensis is the prominent source of natural
rubber. In many of its most significant applications, natural
rubber cannot be replaced by synthetic alternatives and
thus it is of high strategic importance. This singularity is
due to the natural rubber unique properties, as resilience,
elasticity, impact and abrasion resistance, efficient heat
dispersion and malleability at cold temperatures (Cornish
2001; Cataldo 2000).
The genetic variability of H. brasiliensis is high at the
center of origin and knowledge on such variability is
fundamental for conservation, breeding and commercial
production of this species. Most often, specific pheno-
types of discrete variation have been used as morpho-
logical markers. In addition, molecular markers could be
highly beneficial as a tool in assisting genetic charac-
terization and breeding (Nodari et al. 1997; Brondani
et al. 1998). Moreover, the conservation of genetic var-
iability and utilization of allied gene resources is critical
for the improvement of crop species, including
H. brasiliensis.
Microsatellites are considered suitable markers for
genetic studies. They have the advantage of combining
co-dominance and high polymorphism plus abundance and
uniform dispersion in plant genomes, so that they are
L. M. Souza and C. C. Mantello contributed equally to this work.
L. M. Souza  C. C. Mantello  M. O. Santos  A. P. Souza (&)
Centro de Biologia Molecular e Engenharia Gene´tica,
Universidade Estadual de Campinas (Unicamp), CP 6010,
Campinas, SP CEP 13083-970, Brazil
e-mail: anete@unicamp.br
P. de Souza Gonc¸alves
Instituto Agronoˆmico de Campinas (IAC), CP 28, Campinas,
SP 13012-970, Brazil
P. de Souza Gonc¸alves
Empresa Brasileira de Pesquisa Agropecua´ria (Embrapa),
Brası´lia, DF, Brazil
A. P. Souza
Departamento de Biologia Vegetal, Instituto de Biologia,
UNICAMP, Campinas, SP, Brazil
123
Conservation Genet Resour (2009) 1:75–79
DOI 10.1007/s12686-009-9018-7
Page 2
hidden
Table 1 Characteristics of 27 microsatellite loci from Hevea brasiliensis
Locus Gene bank
accession no.
Primer sequence (50–30) Repeat motif N TA (8C) Size
range (bp)
Ho He PIC P value
HWE
HB-1 FJ919780 CTGATGCTGCCAAGCAATAC (tg)10 9 60 186–165 0.645 0.732 0.687 0.623
CAAACATCGCACTCTCCTCA
HB-2 FJ919781 TGGGCACAGTTTTACAAATAGC (ca)8 4 60 240–232 0.258 0.562 0.512 0.000*
CACCATGAAATGAATGCCTCT
HB-3 FJ919782 CACCCACATTAACAGGGACA (tg)8 4 60 255- 240 0.200 0.445 0.412 0.007*
GGTTGCCTTGCTGCTCAT
HB-4 FJ919783 GGAAGAAAAGGGAATAGAGAGC (ac)10(aa)(ac)5 5 60 177–150 0.645 0.611 0.520 0.092
ACCCTGCTTAGGCTTGAATG
HB-6 FJ919785 TGAAAGAAAATGGTGGCTCA (ac)6 2 60 237- 235 0.413 0.406 0.319 0.847
AAAATTCGGGCAAGTCAAGA
HB-7 FJ919786 AACTTCGCATGAGAGCACAA (ac)6 2 60 165–162 0.896 0.508 0.374 0.000*
ACTGTTGACTTTGCCTCCAC
HB-8 FJ919787 GGAGGTATTGCTCATGTATGCT (ca)9 6 60 217–210 0.133 0.329 0.312 0.000*
AGGGCCTTTTACAATGTGGA
HB-9 FJ919788 CACTCATCCATGGTTTTAATGG (gt)8 16 60 198–168 0.666 0.883 0.858 0.595
CCATGGAGGCTCTGAAGTG
HB-10 FJ919789 CACTCATCCATGGTTTTAATGG (gt)7(atgt)(ga)17 10 60 203–168 0.633 0.831 0.798 0.584
CTCCATGAGGCTCTGAAGTG
HB-11 FJ919790 AAAATTCGGGCAAGTCAAGA (gt)6 4 60 252–249 0.333 0.568 0.511 0.005*
TGAAAGAAAATGGTGGCTCA
HB-12 FJ919791 AGAATAAAGCCTCCGTGTCG (ag)20 9 60 246–224 0.548 0.719 0.662 0.474
GAAGCCAAATGTGTCAGTGC
HB-14 FJ919792 TGGGAGAAAGTGGAGGAGAA (ta)5 2 57 234–232 0.064 0.228 0.199 0.000*
CACCACCTTGTTCCACATTG
HB-15 FJ919793 CGTTGAACGATTTGGAGATG (ag)5 e (ag)17 11 60 218–194 0.677 0.858 0.827 0.032*
GCTTGGTTTTGGAAGACTGC
HB-16 FJ919794 CGGGTATAGTGGGAGCAGAG (aag)6 6 60 198–188 0.387 0.650 0.576 0.048*
ACACAACGCCACTGCTTATG
HB-17 FJ919795 AGGGCTTCGGGACAATCA (at)4(gt)6 10 60 212–201 0.666 0.742 0.700 0.956
GACATATGCCCCAACAAGTG
HB-18 FJ919796 AAGGGGAAAAGAAGAAGAAA (ag)10 2 57 148–146 0.290 0.252 0.217 0.344
AAGCCCAAAGAAAAAGAAGT
HB-19 FJ919797 AATGGTGTTGCAATGTTTCA (ag)16 7 57 212–197 0.551 0.770 0.719 0.335
CGTGGGTTCTTCCTTTCA
HB-20 FJ919798 TATTGGCTTGCCTTCTAACC (gt)13(ga)14 6 60 150–124 0.322 0.343 0.322 0.852
CCTTGCACCCACTATCATCT
HB-21 FJ919799 TTAATTTTATCAGCCTTTTT (ca)3 e (at)5 8 47 164–145 0.400 0.545 0.519 0.171
GCATTTTACAGTATTTTGAA
HB-22 FJ919800 ATGATCGCTATTCGCTATGG (ct)17 3 60 178–167 0.500 0.406 0.331 0.290
GATTTGCCCTTCGTCTCC
HB-24 FJ919801 GCCAAATCAATCACTCATCC (ca)11 9 60 264–232 0.269 0.435 0.414 0.013*
GTGCTTCGGCTCAATCTGTT
HB-25 FJ919802 ATGACGCAACTTCTTTCTCC (ga)5 e(tg)9 4 60 226–217 0.222 0.608 0.523 0.000*
TGTTTGTATCTTGCCTTTCT
HB-26 FJ919803 TTGCCGAAAGGTAACTCA (tg)7 2 56 163–162 0.000 0.130 0.120 0.000*
TGTAATTTGCTGTCCACTTC
HB-27 FJ919804 AGTCGTTGTTGTCACCATCA (ttc)6 6 60 177–153 0.225 0.607 0.528 0.000*
TATTCTCCTTGTCGTTGTCG
76 Conservation Genet Resour (2009) 1:75–79
123
Page 3
hidden
capable of discriminating closely related individuals
(Brondani et al. 1998).
Cross-species amplification is highly useful and depends
on the extent of the DNA sequence conservation in the
primer sites flanking the microsatellite loci and the stability
of those sequences during the species evolution (Choumane
et al. 2000; Decroocq et al. 2003; Zucchi et al. 2003).
Closely related species are more likely to share similar
Table 1 continued
Locus Gene bank
accession no.
Primer sequence (50–30) Repeat motif N TA (8C) Size
range (bp)
Ho He PIC P value
HWE
HB-28 FJ919804 ACAACGACAAGGAGAATAGG (gtg)5 3 60 160–154 0.344 0.305 0.279 0.262
CAATCGAATAATCACAGACG
HB-29 FJ919805 AGAAACATGCAAGGGAACAC (tc)16 9 56 183–163 0.733 0.736 0.692 0.428
AGCGGACATACGAAGGAA
HB-30 FJ919806 ATAAACACAAGTGAGTCCTG (tc)16 9 51 234–208 0.193 0.648 0.620 0.000*
GTTTAGTATATCCCATCCAC
Shown are the loci names, the GenBank accession number, the forward and reverse primer sequence, repeat motif, number of alleles (N), product
size range in base pairs, observed (Ho) and expected (He) heterozygoties and P value HWE
*Departs significantly from HWE at P \ 0.05 after Bonferroni correction
Table 2 Cross-amplification of developed H. brasiliensis microsatellite loci in others species of Hevea
Primer H. guianensis H. rigidifolia H. benthamiana H. camargoana H. nitida H. pauciflora (112 CNSG) H. pauciflora (116CNSG)
HB-1 ? ? ? ? ? ? ?
HB-2 - ? ? - ? ? ?
HB-3 ? ? ? ? ? ? ?
HB-4 - ? - ? ? ? ?
HB-6 ? - ? ? - ? ?
HB-7 ? ? ? ? ? - ?
HB-8 ? - ? ? ? ? -
HB-9 ? - ? ? - - ?
HB-10 ? ? - ? ? ? ?
HB-11 ? ? ? ? ? ? ?
HB-12 ? ? ? ? ? ? ?
HB-13 - - ? ? ? ? ?
HB-14 ? ? ? ? ? ? ?
HB-15 ? ? ? ? ? ? ?
HB-16 ? ? ? ? ? ? ?
HB-17 ? ? ? ? ? ? ?
HB-18 ? ? ? ? ? ? ?
HB-19 ? ? ? ? ? ? ?
HB-20 ? ? ? ? ? - ?
HB-21 - - - ? ? - -
HB-22 ? ? ? ? ? ? ?
HB-23 ? ? ? ? ? ? ?
HB-24 ? ? ? ? ? - ?
HB-25 - ? ? ? ? ? ?
HB-26 - ? ? ? ? ? ?
HB-27 ? - ? ? ? ? ?
HB-28 ? - ? ? ? ? ?
HB-29 ? ? ? ? ? ? ?
HB-30 ? ? ? ? ? ? ?
Conservation Genet Resour (2009) 1:75–79 77
123
Page 4
hidden
microsatellite priming sites, but also transfer of functional
microsatellite primers is occasionally possible from more
distantly related species (Lorieux et al. 2000).
In this work, we report the development of H. brasili-
ensis primers for amplification of polymorphic microsat-
ellite loci, which are suitable to cross-amplify in six wild
Hevea species and useful for genetic diversity studies of
Hevea spp. germplasm.
The studied germplasm comprised 31 genotypes of the
rubber tree H. brasiliensis, which were gently provided by
the Agronomic Institute of Campinas (IAC), as well as the
wild congeneric species H. guianensis, H. rigidifolia,
H. nitida, H. pauciflora, H. benthamiana and H. camar-
goana, gently provided by the Brazilian Agricultural
Research Corporation (EMBRAPA—Amazoˆnia Ocidental)
in Manaus, AM.
Genomic DNA samples were extracted from lyophilized
leaf tissues using a modified CTAB method (Doyle and
Doyle 1987). A genomic enriched library for H. brasiliensis
was constructed according to the methodology described by
Billotte et al. (1999). The DNA samples were digested with
RSAI and enriched using (CT)8 and (GT)8 biotinylated
microsatellite probes. Selected DNA fragments were
amplified by PCR and then cloned into the pGEM-T vector
(Promega). Competent XL1-blue Escherichia coli cells were
transformed with the recombinant plasmids and cultivated
on agar medium containing ampicillin and 100 lg/ml of
X-galactosidase. Clones containing the insert were
sequenced using the Big Dye Terminator v3.1 Cycle
Sequencing Kit (Applied Biosystems) and an automated ABI
377 sequencer (Applied Biosystems).
Of the sequenced E. coli clones, 41.2% contained sim-
ple sequence repeats. From the 79 sequenced clones with
microsatellite motifs, a total of 27 primer pairs comple-
mentary to sequences flanking the repeat motifs were
designed using PrimerSelect (DNAStar). Polymorphism
was evaluated in 31 H. brasiliensis genotypes from the
IAC germoplasm collection. The microsatellite fragments
were PCR amplified in 25 ll reaction volume, consisting of
20 ng of template DNA, 0.8 lM of each primer, 200 lM
of each dNTP, 1.5 mM MgCl2, 20 mM Tris–HCl, 50 mM
KCl, and 0.5 U Taq DNA Polymerase. Immediately after
an initial denaturation at 94C for 4 min, PCR amplifica-
tions were performed in 30 cycles of 1 min at 94C, 45 s at
the specific annealing temperature of each primer pair and
1 min at 72C, followed by a final extension at 72 for
10 min. PCR products were separated by electrophoresis
on denaturing acrylamide gels and silver stained (Creste
et al. 2001). Molecular size of the DNA fragments was
estimated by comparison with standard 10-bp DNA Ladder
(Invitrogen).
The 27 evaluated microsatellite loci were polymorphic
and showed single-locus amplification (Table 1) in the 31
H. brasiliensis genotypes. The number of alleles per locus
varied from 2 to 16. The observed (Ho) and expected (He)
heterozygosity ranged from 0.13 to 0.88 and from 0.0001
to 0.89, respectively. Descriptive statistics and the test for
Hardy–Weinberg Equilibrium were performed using Tools
for Genetic Population Analysis (TFPGA) (Miller 1997).
Thirteen loci depart significantly from Hardy-Weinberg
Equilibrium (P \ 0.05) (Table 1). The linkage disequilib-
rium was tested using the Popgene 1.32 (Yeh et al. 1998)
and no disequilibrium was detected among all loci. The
Polymorph Information Content (PIC) ranged from 0.12 to
0.85 (Table 1).
Cross-species amplifications of the 27 loci in the six
wild species H. guianensis, H. rigidifolia, H. nitida,
H. pauciflora (112 CNSG and 116 CNSG), H. benthami-
ana and H. camargoana was investigated using equal PCR
conditions. The 27 loci were successfully amplified on the
evaluated Hevea species (Table 2). The species H. guian-
ensis, H. rigidifolia and H. pauciflora showed a duplicated
locus for the HB30, HB17 and HB18 microsatellites,
respectively. Locus duplication in H. brasiliensis was
previously reported by Seguin et al. (1996); Lespinasse
et al. (2000), however, this is the first report of loci
duplication in other Hevea species.
The data presented herein demonstrated a high poten-
tial applicability of these isolated microsatellites markers
for analyses of intra- and interspecific genetic diversity
and gene flow, as well as phylogenetic relationships
among the cultivated rubber tree H. brasiliensis and wild
Hevea species. These studies will be of considerable
value for the conservation and use of Hevea genetic
resources.
Acknowledgments The authors thank the Brazilian Agricultural
Research Corporation (EMBRAPA - Amazoˆnia Ocidental) and the
Agronomic Institute of Campinas for donating the analyzed Hevea
germoplasm. The present research was financed by the Fundac¸a˜o de
Amparo a` Pesquisa do Estado de Sa˜o Paulo (FAPESP, 2007/50392-1,
2007/59804-0); L.M.S. and C.M.C. received respectively a under-
graduate and graduate scholarship from FAPESP. A.P.S. and P.S.G.
received a research fellowship grant from Conselho Nacional de
Desenvolvimento Cientı´fico e Tecnolo´gico (CNPq).
References
Billotte N, Lagoda PJR, Risterucci AM, Baurens FC (1999)
Microsatellite-enriched libraries: applied methodology for the
development of SSR markers in tropical crops. Fruits 54:277–
288
Brondani RPV, Brondani C, Tarchini R, Grattapaglia D (1998)
Development, characterization and mapping of microsatellite
markers in Eucalyptus grandis and E. urophylla. Theor Appl
Genet 97:816–827
Cataldo F (2000) Guayule rubber: a new possible world scenario for
the production of natural rubber. Prog Rubber Plast Technol
16:31–59
78 Conservation Genet Resour (2009) 1:75–79
123
Page 5
hidden
Choumane W, Winter P, Weigand F, Kahl G (2000) Conservation and
variability of sequence-tagged microsatellite sites (STMSs) from
chickpea (Cicer aerietinum L.) within the genera Cicer. Theor
Appl Genet 101:269–278
Clement-Demange A, Legnate H, Seguin M, Carron MP, Le Guen V,
Chapuset T (2000) Rubber tree. In: Charrier A, Jacquot M,
Hamon S, Nicolas D et al (eds) Tropical plant breeding.
Collection Reperes, CIRAD-ORSTOM, Montpellier, France,
pp 455–480
Cornish K (2001) Similarities and differences in rubber biochemistry
among plant species. Phytochem 57:1123–1134
Creste SA et al (2001) Detection of single sequence repeat
polymorphism in denaturating polyacrylamide sequencing gels
by silver staining. Plant Mol Biol Rep 19:299–306
Decroocq V, Fave MG, Hagen L, Bordenave L, Decroocq S (2003)
Development and transferability of apricot and grape EST
microsatellite markers across taxa. Theor Appl Genet 106:912–
922
Doyle JJ, Doyle JL (1987) A rapid DNA isolation procedure for small
quantities of fresh leaf tissue. Phytochem Bull 19:11–15
Lespinasse D et al (2000) Identification of QTLs involved in the
resistance to South American Leaf Blight (Microcyclos ulei) in
the rubber tree. Theor Appl Genet 100:975–984
Lorieux M, Ndjiondjop M-N, Ghesquie`re A (2000) A first interspe-
cific Oryza sativa & Oryza glaberrima microsatellite-based
genetic linkage map. Theor Appl Genet 100:593–601
Miller MP (1997) Tools for population genetic analysis (TFPGA) 1.3.
A windows program for the analysis of allozyme and molecular
population genetic data. Computer software distributed by author
Nodari RO, Ducroquet JP, Guerra MP, Meler K (1997) Genetic
variability of Feijoa sellowiana germplasm. Acta Hort 452:
41–46
Pires JM, Secco RS, Gomes JI (2002) Taxonomia e fitogeografia das
seringueiras Hevea spp. Embrapa Amazoˆnia Oriental, Bele´m,
p 103
Seguin M et al (1996) Hevea molecular genetics. Plant Rech Dev
3:77–88
Yeh FC, Rong-Cai Y, Boyle T (1998) POPGENE version 1.31.
Edmonton. University of Alberta, Center for InternationalFor-
estry Research, Alberta, Canada
Zucchi MI, Brondani RPV, Pinheiro JB, Chaves LJ, Coelho ASG,
Vencovsky R (2003) Genetic structure and gene flow in Eugenia
dysenterica DC in the Brazilian Cerrado utilizing SSR markers.
Genet Mol Biol 26:449–457
Conservation Genet Resour (2009) 1:75–79 79
123

Sign up today - FREE

Mendeley saves you time finding and organizing research. Learn more

  • All your research in one place
  • Add and import papers easily
  • Access it anywhere, anytime

Start using Mendeley in seconds!

Already have an account? Sign in

Readership Statistics

7 Readers on Mendeley
by Discipline
 
 
by Academic Status
 
29% Ph.D. Student
 
29% Student (Postgraduate)
 
14% Student (Master)
by Country
 
29% China
 
29% Brazil
 
14% India