Sign up & Download
Sign in

Mutational, functional, and expression studies of the TCF4 gene in Pitt-Hopkins syndrome.

by Loïc De Pontual, Yves Mathieu, Christelle Golzio, Marlène Rio, Valérie Malan, Nathalie Boddaert, Christine Soufflet, Capucine Picard, Anne Durandy, Angus Dobbie, Delphine Heron, Bertrand Isidor, Jacques Motte, Ruth Newburry-Ecob, Laurent Pasquier, Marc Tardieu, Géraldine Viot, Francis Jaubert, Arnold Munnich, Laurence Colleaux, Michel Vekemans, Heather Etchevers, Stanislas Lyonnet, Jeanne Amiel show all authors
Human Mutation (2009)

Abstract

Pitt-Hopkins syndrome is a severe congenital encephalopathy recently ascribed to de novo heterozygous TCF4 gene mutations. We report a series of 13 novel PHS cases with a TCF4 mutation and show that EEG, brain magnetic resonance imagain (MRI), and immunological investigations provide valuable additional clues to the diagnosis. We confirm a mutational hot spot in the basic domain of the E-protein. Functional studies illustrate that heterodimerisation of mutant TCF4 proteins with a tissue-specific transcription factor is less effective than that homodimerisation in a luciferase reporter assay. We also show that the TCF4 expression pattern in human embryonic development is widespread but not ubiquitous. In summary, we further delineate an underdiagnosed mental retardation syndrome, highlighting TCF4 function during development and facilitating diagnosis within the first year of life.

Cite this document (BETA)

Available from Heather Etchevers's profile on Mendeley.
Page 1
hidden

Mutational, functional, and expression studies of the TCF4 gene in Pitt-Hopkins syndrome.

Human MutationRESEARCH ARTICLE
Mutational, Functional, and Expression Studies of the
TCF4 Gene in Pitt-Hopkins Syndrome
Loı¨c de Pontual,1 Yves Mathieu,1 Christelle Golzio,1 Marle`ne Rio,2 Vale´rie Malan,1 Nathalie Boddaert,3
Christine Soufflet,4 Capucine Picard,5,6 Anne Durandy,5 Angus Dobbie,7 Delphine Heron,8 Bertrand Isidor,9
Jacques Motte,10 Ruth Newburry-Ecob,11 Laurent Pasquier,12 Marc Tardieu,13 Ge´raldine Viot,14 Francis Jaubert,15
Arnold Munnich,1,2 Laurence Colleaux,1 Michel Vekemans,1,2 Heather Etchevers,1 Stanislas Lyonnet,1,2 and Jeanne Amiel1,2
1Unite´ INSERM U-781, Universite´ Paris Descartes, Faculte´ de Me´decine, INSERM
2Service de Ge´ne´tique et de Cytoge´ne´tique, Hoˆpital Necker-Enfants Malades, AP-HP, Paris, France
3Radiologie Pe´diatrique, INSERM U-797, Hoˆpital Necker-Enfants Malades, Paris, France
4Service de Neurophysiologie, INSERM U-663, Hoˆpital Necker-Enfants Malades, Paris, France
5Unite´ INSERM U-768, Hoˆpital Necker-Enfants Malades, Paris, France
6Study Center of Immunodeficiencies, Universite´ Paris-Descartes, Faculte´ de Me´decine; AP-HP, Hoˆpital Necker-Enfants Malades, Paris, France
7Genetics Service, St. James’s University Hospital, Leeds, United Kingdom
8De´partement de Ge´ne´tique, Hoˆpital de la Pitie´-Salpe´trie`re, Paris, France
9Service de Ge´ne´tique, Hoˆpital de l’Hoˆtel Dieu, Nantes, France
10Service de Neurologie Pe´diatrique, American Memorial Hospital, CHU de Reims, France
11Department of Clinical Genetics, Level B, St. Michael’s Hill, Southwell Street, Bristol BS2 8EG, United Kingdom
12Service de Ge´ne´tique Clinique, Hoˆpital Sud, Rennes, France
13Service de Neurologie Pe´diatrique, Hoˆpital Bice`tre, Le Kremlin Bice`tre, France
14Service de Ge´ne´tique, Hoˆpital Cochin, Paris, France
15Service d’anatomie pathologique, Hoˆpital Necker-Enfants Malades, Paris, France
Communicated by Ian McIntosh
Received 15 July 2008; accepted revised manuscript 7 October 2008.
Published online 20 February 2009 in Wiley InterScience (www.interscience.wiley.com). DOI 10.1002/humu.20935
ABSTRACT: Pitt-Hopkins syndrome is a severe congenital
encephalopathy recently ascribed to de novo heterozygous
TCF4 gene mutations. We report a series of 13 novel PHS
cases with a TCF4 mutation and show that EEG, brain
magnetic resonance imagain (MRI), and immunological
investigations provide valuable additional clues to the
diagnosis. We confirm a mutational hot spot in the basic
domain of the E-protein. Functional studies illustrate that
heterodimerisation of mutant TCF4 proteins with a tissue-
specific transcription factor is less effective than that
homodimerisation in a luciferase reporter assay. We also
show that the TCF4 expression pattern in human embryonic
development is widespread but not ubiquitous. In summary,
we further delineate an underdiagnosed mental retardation
syndrome, highlighting TCF4 function during development
and facilitating diagnosis within the first year of life.
Hum Mutat 30, 669–676, 2009. & 2009 Wiley-Liss, Inc.
KEY WORDS: Pitt-Hopkins; TCF4; bHLH; E-protein;
mental retardation
Introduction
Pitt-Hopkins syndrome (PHS; MIM] 610954) was originally
described in 1978 in two unrelated patients with mental retardation,
recurrent episodes of hyperventilation, and a wide mouth [Pitt and
Hopkins, 1978]. Only a few additional cases were reported during
the following quarter century [Orrico et al., 2001; Peippo et al.,
2006; Singh, 1993; Van Balkom et al., 1998]. Using a systematic
1-Mb resolution genome-wide BAC-array screening, we and others
recently identified de novo microdeletions on chromosome 18q21.1
in PHS cases [Amiel et al., 2007; Brockschmidt et al., 2007;
Gustavsson et al., 1999; Zweier, et al., 2007]. Fine mapping of the
deleted region led to the identification of heterozygous TCF4 gene
mutation in nondeleted cases. TCF-4 (MIM] 602272), also known
as ITF-2 (for immunoglobulin transcription factor), E2-2, or SEF2
(for SL3-3 enhancer factor 2), belongs to the class I basic helix-
loop-helix (bHLH) or E-protein family. Ubiquitously expressed
class I bHLH factors consist of TCF4, HEB, and the differentially
spliced products of the E2A gene: E12 and E47 (Murre, 2005).
E-proteins contain a common bHLH structural motif that mediates
homo- and heterodimerization between bHLH proteins via their
HLH domain, while the adjacent basic region mediates the binding
of the dimers to a common DNA sequence (CANNTG), known as
an E- BOX [Ross et al., 2003].
Here we report 13 molecularly confirmed novel cases with PHS
and further delineate the syndrome. Although severe mental
retardation and a facial gestalt are the only consistently observed
features, diagnosis can be made in the first year of life.
Electroencephalograms (EEG), magnetic resonance imaging
OFFICIAL JOURNAL
www.hgvs.org
& 2009 WILEY-LISS, INC.
Grant sponsors: Agence Nationale pour la Recherche (ANR); the Fondation pour la
Recherche Me´dicale (FRM)
Correspondence to: Jeanne Amiel, De´partement de Ge´ne´tique, Hoˆpital Necker-
Enfants Malades, 149, rue de Se`vres, 75743 Paris Cedex 15, France.
E-mail: Jeanne.amiel@inserm.fr
Page 2
hidden
(MRI) of the brain, and immunological investigations provide
further evidence to support the diagnosis.
We confirm a mutational hot spot within the basic domain of
TCF4. Although TCF4 is widely expressed in early human embryo,
its spatiotemporal pattern is quite specific. Finally, because certain
features of PHS depend on dimeric interactions with tissue-
specific bHLH proteins, we studied the transactivation induced by
ASCL1/TCF4 wild-type and mutant dimmers in a neuronal cell
line, by using a Delta 1 promoter reporter construct. Overall, we
demonstrate that E-proteins are not fully redundant during
human development, and that TCF4 is required for normal
development of central and enteric nervous systems.
Materials and Methods
Patients
A total of 36 patients were included in the study. Inclusion criteria
were: (1) severe psychomotor delay and (2) facial features compatible
with those previously described in PHS patients. Ten patients were
selected from photographs of a series of about 80 patients previously
suspected of having Rett and/or Angelman syndromes but were
negative for UBE3A and MECP2 mutations. One patient was selected
from the photographs of 30 patients referred for possible Mowat-
Wilson syndrome, negative for ZFHX1B mutation. Twenty-five
patients were directly referred for possible PHS.
TCF4 screening for mutations
Blood samples were obtained with informed consent and DNA
was extracted according to standard protocols. The PCR reaction
mixture (25 ml) contained 100 ng of leukocyte DNA, 20 pmol of
each primer (sequences of primers available on request), 0.1 mM
dNTP, and 1U Taq DNA polymerase (Invitrogen, San Diego, CA).
DNA sequencing of the 21 coding exons and intronic flanking
regions was performed by the fluorometric method on both
strands (ABI BigDye Terminator Sequencing Kit V.2.1, Applied
Biosystems, Foster City, CA). At least five isoforms of TCF4 are
known; we chose the longer one (GenBank accession number
NM_003199.2) for mutation classification. Nucleotide numbering
reflects cDNA numbering with 11 corresponding to the A of the
ATG translation initiation codon. The initiation codon is codon 1.
In all cases, chromosome analyses showed a normal karyotype.
When no mutations were identified, patients were genotyped with
two intragenic microsatellite DNA markers D18S1119 and
D18S1127, and FISH analyses was performed for homo/hemi-
zygous patients on metaphase nuclei from blood lymphocytes
with the probe RP11-397A16.
Construction of Plasmids and Luciferase Assay
Human cDNA of TCF4 and ASCL1 insert in a pBluescriptR vector
were obtained from the MRC Laboratory and inserted into pcDNA
3.1/zeo (). Known TCF4 mutations (c.1727G4A p.R576Q,
c.1726C4T p.R576W, c.1714G4A p.R572G, c.1521_1522insC
p.Ser508LeufsX5, c.1498G4T p.G500X) were generated using the
quikChanges XL Site-Directed Mutagenesis Kit (Stratagene, LaJolla,
CA) according to the manufacturer’s protocol. All constructs were
validated by DNA sequencing and subcloned into a pcDNA3.1 vector
(Invitrogen) containing a T7 promoter. The luciferase reporter
construct (F. Guillemot, National Institute for Medical Research, Mill
Hill, Londres) contains the firefly luciferase gene under the control of
a Delta 1 promoter and 6 E-boxes [Castro et al., 2006]. HeLa cells
were grown to 95% confluency in Dulbecco’s minimum essential
medium supplemented with 10% fetal bovine serum in 12-well
plates. Cells were transfected with 300ng of expression vector, 600ng
of the firefly luciferase reporter promoter, 30 ng of pRL-CMV Renilla
luciferase internal control (Promega, Madison, WI), and 4ml of
Fugene HD (Roche, Indianapolis, IN) in 100ml of OPTI-MEM
(Invitrogen). Cells were harvested and lysed 24–48hr after transfec-
tion. Firefly and Renilla luciferase activities were assayed according to
the manufacturer’s protocol. Luciferase activity of each construct was
normalized by the internal control pRL-CMV. Experiments were
repeated three times in duplicate.
Immunological Investigations
Serum immunoglobulin levels were determined by immunoen-
zymatic assays using monoclonal antibodies. B and T lymphocytes
counts were enumerated using specific antibodies to surface
markers on a Fluorescent Analysis Cell Sorter as previously
described [Revy et al., 2000].
In Situ Hybridization and Immunohistochemistry on
Human Tissues
Human embryos were collected from terminated pregnancies
using the mefiprestone protocol in agreement with French
bioethics laws (94–654 and 04–800) and the Necker Hospital
ethics committee. Intact embryos were fixed in either 4%
paraformaldehyde, pH 7.4, or 11% formaldehyde, 60% ethanol,
and 10% acetic acid, embedded in paraffin blocks and sectioned
at 5 mm. Primers were selected for PCR amplification between
exons 7 and 8 (F: ccagactggagatgctgtgg, R: ggagactctgccctgta). A T7
promoter sequence extension (taatacgactcactatagggaga) was added
at the 50 end of each primer; probe synthesis and hybridization
were carried out as described previously [Delous et al., 2007].
Immunohistochemistry was carried out on paraffin sections using
an anti-CD56 (antineural cell adhesion molecule) or antisynapto-
tagmin primary antibody and a standard protocol for signal
staining by diaminobenzidine precipitation with a hematoxylin
counterstain. The gut sample is from a five year old boy who
underwent surgery for Meckel diverticulum.
Results
Clinical Presentation of Patients Harbouring a TCF4
Gene Mutation
All patients had severe mental retardation with speech limited
to a few single words or no speech. Motor delay was also constant
only some patients could walk unaided after 4 years of age. Facial
features consistently included enophthalmia, strabismus, thin
eyebrows with flaring in their midline portion, a large nose with
high bridge and flared nostril, a protruding philtrum, M-shaped
Cupid’s bow, fleshy lips and wide mouth with shallow and broad
palate, widely spaced teeth, dysplastic and thick ear helices
(Table 1 and Fig. 1). With age, traits coarsen and the lower face
protrudes more. Acquired microcephaly was observed in nine
cases, among which growth retardation was present in three
patients only. Stereotypic and restless movements of hands, head,
and trunk was found in eight patients that retained purposeful
hand skills. Relatives described bouts of shouting and aggressive
behavior, being difficult to handle. The ‘‘happy, easy-going’’
temper is not as frequent as initially mentioned. Sleep disorders
were only reported in a minority of patients.
Only six patients suffered from epilepsy, usually of late onset
(after 5 years of age in this series) and of variable severity.
670 HUMAN MUTATION, Vol. 30, No. 4, 669–676, 2009
Page 3
hidden
However, two patients presented with infantile spasms at 4 and 6
months of age, respectively. In one case, this followed enterovirus
meningitis at 4 months of age; del18q21 was diagnosed at 4 years
of age. An EEG performed at 16 months of age showed left
rolandic focal spikes subcontinuous during sleep with several focal
seizures recorded. Episodes of hyperventilation also were not
constant; they tended to be more frequent in epileptic patients and
of earlier occurrence than the epilepsy itself. Frontal Pseudoper-
iodic Delta Waves (FPDW) during wakefulness and sleep were
observed in five of eight cases and preceded the onset of epilepsy
in three cases. MRI of the brain was available for 11 patients. All
but one shown a thin corpus callosum, marked white-matter
hyperintensity in the temporal poles, and small hippocampi.
Minor anomalies of the extremities were frequent and included
small and slender palms with single palmar crease, and slender feet
with pes planus and valgus. Of note, limited flexion of the P1–P2
thumb joint with absent flexion crease was noted in three of four
patients harbouring a deletion encompassing the TCF4 locus and
none of the patients harbouring a TCF4 coding sequence mutation.
This was seen also in the patient reported by Andrieux et al. [2008].
Cryptorchidism and/or small penis was frequently noted (six to
eight males). Severe chronic constipation of early onset (within the
first year of life) was frequently recorded as well as gastrooesopha-
geal reflux and eructation. However, no patient had Hirschsprung
disease or other organ malformations in our series.
Among the patients with no coding sequence mutations and no
deletions detected by FISH analyses none have the PHS facial
gestalt identified among patients with a TCF4 mutation.
TCF4 Mutations
We screened the coding sequence of the 21 exons of the TCF4 gene
for nucleotide variations in a series of 36 PHS patients and identified
13 mutations (Fig. 2). No mutations observed were detected in a
panel of 120 control chromosomes. We identified five putative null
alleles mutations: two splice site mutations (c.923-2A4G and c.1146
11G4A), two frameshift mutations (c.1472_1473insA p.As-
p492GlyfsX21 and c.1521_1522insC p.Ser508LeufsX5), and one
nonsense mutation (c.1498G4T p.G500X). Any polypeptide
translated from transcripts bearing one of these mutations would
be predicted to lack the bHLH domain.
We also identified four missense mutations (c.1471A4G,
p.D535G, c.1714G4A, p. R572G, c.1727C4G, p.R576Q, and
c.1823C4T, p.A610V). All missense mutations modify amino
acids highly conserved in mammalian TCF4 genes (ClustalW
analysis, data not shown). All mutations were de novo except for
the p. R572G, c.1725C4G mutation. It was also identified in the
patient’s mother for DNA extracted from leucocytes and urethral
cells but not for buccal swabs. A mosaic state for the mutation was
confirmed by direct sequencing from buccal swabs that showed a
normal sequence (data not shown). We concluded that the
mother, who was treated for chronic depression and epilepsy from
20 years of age, is somatic mosaic for the mutation. Finally, a
deletion encompassing the TCF4 gene was detected in three cases
by FISH analysis.
Functional Analysis of TCF4 Mutant Alleles
Mutant cDNAs were stable and therefore could be amplified by
RT-PCR extracted from lymphocytes. Cotransfection of TCF4 and
ASCL1 cDNAs with a luciferase reporter construct containing a
Delta1 promoter with six E-boxes in HeLa (data not shown) and
SKNBE(2)C cells (Fig. 5) showed that wild-type TCF4 activates
the reporter construct only when cotransfected with ASCL1. The
activation was significantly and similarly impaired for nonsense,
frameshift, and missense TCF4 mutants, c.1498G4T p.G500X,
c.1727G4A p.R576Q, and c.1726C4T p.R576W (Fig. 3). We
therefore showed a loss of function effect of all mutants. Finally, a
dominant negative effect cannot be ruled out as luciferase activity of
ASCL11/TCF4 mutants is lower than the one of ASCL11/TCF4.
Immunologic Investigations
As Tcf4 is involved in fetal B lymphocyte development in mice
[Zhuang et al. 1996], we investigated cellular and humoral
Table 1. Clinical Features in the Series of 13 Newly Described PHS Patients, the 4 Patients Previously Reported by Us and the 9
Reported by Others.
This report
(N5 13)
Amiel et al.
(N5 4)
Zweier et al.
(N5 6)
Gustavsson
et al.
Brockschmidt
et al.
Andrieux
et al.
Age at diagnosis (years) 0.8 to 29 4.5 to 10 8 to 29 5 6 12
Sex 10M/3F 2M/2F 4M/2F F F M
Birth parameters 50th c. 50th c. 25 to 50th c. 50th c. 50th c.
Growth retardation (r-2 SD) 3/12 0/4 4/6  1
Neurologic findings
Severe mental retardation 13/13 4/4 6/6 1 1 1
Postnatal microcephaly 9/12 4/4 4/6   1
Epilepsy (age at onset) 6/11 (0.2–18y) 3/4 2/6 1  
Hyperventilation (age at onset) 4/13 (3–7y) 3/4 5/6 1 1 
Stereotypic movements 8/11 4/4 (4,2) ? 1 
Strabismus 11/13 4/4 2/4 1 ?
Facial gestalt 13/13 4/4 6/6 1 1 1
Abormal genitaliaa 7/9M 2/2M ? 
Intestinal manifestations 9/12 4/4 3/6 1  
Scoliosis 2/12 1/4 2/6 1  
Hands (small, SPC) 5/13 4/4 ?  SPC SPC
Flexion of thumbs 2 1 
Supernumerary nipple 1 2/4 1   1
EEG abnormalities 8/9 4/4 2
MRI 6/7 3/3 2 CCA  CCH
Results of TCF4 gene screening 3del, 2S, 3T, 4Ms 1del, 3Ms 1del, 1S, 2T, 1Ms, 1Fs del18q21.1q2.3 del 0.5Mb del 6.2Mb
aCryptorchidism and/or small penis. GenBank accession number NM_003199.2.
M, male; F, female; SPC, single palmer crease; CCA, corpus callosum agenesia; CCH, corpus callosum hypoplasia; del, deletion; S, slice site mutation; T, trucating mutation;
Ms, missense mutation.
HUMAN MUTATION, Vol. 30, No. 4, 669–676, 2009 671
Page 4
hidden
immunity in eight PHS patients. No susceptibility to infections
was reported, except for one case who experienced one episode of
urinary tract infection and severe chickenpox. Immunologic
investigations revealed normal B (including switched memory)
and T CD41and CD81lymphocyte count, and appropriate
postvaccination or postinfection serology. However, serum
Figure 1. Consistent facial features include enophthalmia, strabismus, thin eyebrows in their midline portion, a large nose with high bridge
and flared nostrils, a protruding philtrum, fleshy lips, wide upper mouth, and dysplastic ear helices in 10 patients with TCF4 mutations (A) and
two patients with TCF4 deletions (B).
672 HUMAN MUTATION, Vol. 30, No. 4, 669–676, 2009
Page 5
hidden
immunoglobulin M levels were in the low normal range according
to age in one case and bellow this range in the seven other cases.
Interestingly, the mother carrying the c.1714G4A p.R572G
mutation had normal immunoglobulin M levels.
TCF4 Expression in Early Human Development
We studied the pattern of expression of TCF4 in early human
development (Fig. 4). TCF4 is highly expressed throughout the
central nervous system (CNS) and sclerotomal component of the
somites (Fig. 4A) from Carnegie stage (C)13 (28–32 days
postfertilization [dpf]). At C15 (35–38 dpf), TCF4 is highly
expressed in the condensing vertebral body (Fig. 4C), as well as
throughout the limb bud and splanchopleural mesenchyme. The
gonadal ridge also expresses TCF4 at this point.
By C18 (44–48 dpf), many but not all additional sites transcribe
TCF4 (Fig. 4F). These include mesenchyme of the developing
digits (Fig. 4G); the primordium of the pituitary gland (Fig. 4I);
NCAM-expressing sympathetic, parasympathetic, and enteric
ganglia (Fig. 3K–P); peribronchial mesenchyme (Fig. 4N), the
gonad, mesonephros and definitive kidney (Fig. 4Q), and
the thyroid and thymus primordial (Fig. 4S). Vertebrae and the
ventricular zone of the CNS continue to strongly express TCF4.
TCF4 expression continues through postnatal life, as we detect
its transcripts by RT-PCR in adult lymphocytes, fibroblasts, gut,
muscle, but not the heart (data not shown). In the small intestine
at 5 years of age, TCF4 mRNA is found in enteric ganglia of the
myenteric plexus (Fig. 5A), which also produce NCAM (Fig. 5B).
However, TCF4 is also transcribed in Paneth cells of the epithelial
crypts (Fig. 5D) as shown by immunoreactivity to synaptotagmin
on an adjacent section (Fig. 5E).
Discussion
PHS is a syndromic encephalopathy with an autosomal
dominant mode of inheritance, due to de novo mutations at the
TCF4 locus. However, genetic counselling should take into
account the possibility of somatic/germinal mosaicism as this
was observed in one case from our series. We confirm in a larger
series than reported previously, a mutational hot spot lying in the
basic domain, with six mutations among 14 coding sequence
mutation PHS cases and four at the same codon ([Amiel et al.,
2007], and this report). The association of severe mental
retardation and facial gestalt allows diagnosis in early life, youngest
being diagnosed at 9 months old in our series. The recognition of a
series of 13 cases over a 12-month period confirms that PHS is more
frequent than implied by the scattered reports made over the past 30
years. Differential diagnoses include Rett (MIM] 312750), Angel-
man (MIM] 105830), and Mowat-Wilson (MIM] 235730)
syndromes. PHS should therefore be systematically considered for
patients with negative molecular screening for MECP2, UBE3A, and/
Figure 2. Schematic representation of deletion and TCF4 gene mutations in our series (top) and in the literature (bottom).
Figure 3. Transcriptional reporter assay with TCF4 wild type (WT)
and mutants. SKNBE(2)C cells were transiently transfected with a
luciferase reporter construct with a Delta1 promoter containing two
E-boxes. TCF4 alone does not increase the activation of the reporter
construct, whereas cotransfection with ASCL1 yields the highest
values of luciferase activity. ASCL1/TCF4 mutant (G500X, R576Q, or
R576W) activity is significantly lower than with ASCL1/TCF4 wild-type
heterodimers (significant p values o0.05 obtained by the Student
t-test are indicated by a star).
HUMAN MUTATION, Vol. 30, No. 4, 669–676, 2009 673
Page 6
hidden
or ZFHX1B. We suggest first screening for TCF4 gene deletion (by
FISH, MLPA, or quantitative PCR) when thumb anomalies are
noted, and to start with direct sequencing when thumbs are normal
(exons 17 and 18 being first). Whether limited flexion of the thumbs
is directly due to TCF4 gene dysfunction or due to adjacent genes in
a contiguous gene syndrome is uncertain. However, we detected a
high level of TCF4 expression in limb buds during foetal
development, whereas no obvious candidate gene is included in
the minimal region of overlap (Fig. 2).
TCF-4 is a downstream target of the WNT/b-catenin/TCF
pathway and, like cMYC and cyclin D1, has been shown to
function as an oncogene when deregulated. Of note, one patient
reported with a TCF4 mutation developed lymphoma [Zweier
et al., 2007]. Recently, Kuiper et al. [2007] identified deletions of
the TCF4 gene in paediatric lymphoblastic leukaemias. The
question of whether PHS patients are predisposed to lymphomas
remains a possibility. Tcf4–/– knockout mice have a reduced
numbers of pro-B cells [Zhuang et al., 1996]. We confirmed TCF4
expression in the thymus and presplenic mesenchyme, and
observed low levels of immunoglobulin M in all patients tested.
These findings help clinical diagnoses of PHS. However, normal B
cell counts (including the more mature, memory-switched B) in
the eight patients tested strongly suggests that either TCF4 is not
involved in B cell differentiation in humans or that TCF4 loss of
function is compensated by other transcription factors. A subtle
humoral defect was nevertheless observed, because all patients
present with a rather low serum IgM level. Of note, mE5/kE2
enhancer sites of immunoglobulin genes are direct targets of TCF4
homodimers as well a TCF3/TCF4 heterodimer [Bain et al., 1993;
Henthorn et al., 1990]. Long-term follow-up should resolve the
question of whether PHS patients are prone to infections,
autoimmune disorders or tumors.
Molecular interaction between TCF4 and ASCL1 has been
demonstrated in humans and mice [Castro et al., 2006; Persson
et al., 2000], and ASCL1 may play a role in the control of
breathing [de Pontual et al., 2003]. We hypothesized that the
breathing anomalies observed in some PHS cases may result from
impaired noradrenergic neuronal development after defective
TCF4 interaction with the ASCL1–PHOX–RET pathway. Zweier
et al. [2007] studied three different TCF4 mutants with a
Figure 4. Pattern of expression of TCF4 in early human development. A: TCF4 is observed throughout the central nervous system (CNS),
sclerotome, and lateral plate mesoderm, and all pharyngeal arch mesenchyme at Carnegie stage (C)13 (28–32 days postfertilization [dpf]). B:
Sense (control) probe hybridization. C: At C15 (35–38 dpf), TCF4 is seen in the condensing vertebral body, throughout the limb bud and
splanchopleural mesenchyme and gonadal ridge. D: Sense probe. E: By C18 (44–48 dpf), many but not all additional sites transcribe TCF4. F:
Hematoxylin-eosin stain of adjacent section indicating magnifications of zones featured in I–T. G: At C19 (49 dpf), precartilaginous (arrow) and
lateral mesenchyme of the developing digits show higher expression of TCF4 than surrounding cells. H: Sense probe. I: At C18 (section in F),
Rathke’s pouch, the diencephalon, pharyngeal arch subectodermal mesenchyme, and the cartilaginous primordia of the sella turcica all show
strong expression. J: Sense probe. K: CD56 (NCAM) immunostain in brown of adjacent section to TCF4 antisense hybridization in blue in L
demonstrates TCF4 transcription in the soma of the sympathetic ganglia. M: CD56 in a parasympathetic ganglion of the lung (arrowhead) and
nerve fibers shows overlap with TCF4 expression (N) only within the ganglion itself. Mesenchymal TCF4 expression surrounds the bronchi. O:
CD56 in mesenchyme (diffuse) and developing enteric plexi of the duodenum. P: The enteric ganglia (arrowheads) coexpress TCF4. Q: The gonad
continues to strongly transcribe TCF4, as do the mesonephrotic tubules and glomeruli and metanephric mesenchyme (kd). R: Sense probe. S:
Mesenchyme of the thyroid and thymic primordial express TCF4 at C18. H: Sense probe. Scale bar: A–B, 1 mm; C–D, 1.3 mm; E–F, 2 mm; G–T,
250 mm.
674 HUMAN MUTATION, Vol. 30, No. 4, 669–676, 2009
Page 7
hidden
transcriptional reporter assay with a herpes simplex thymidine
kinase promoter in JEG-3 cells and showed that the activation of
TCF4/ASCL1 dimer was significantly impaired for all TCF4
mutants tested. We confirmed these results in a more
relevant neural cell line using a Delta 1 promoter reporter
construct (Fig. 3).
Unexpectedly, the TCF4 spatiotemporal expression pattern is
broad but not ubiquitous. For example, TCF4 expression could not
be detected in the myocardium by either in situ hybridization or
RT-PCR. Moreover, TCF4 expression is highest in the central
nervous system, the sclerotome, peribronchial and kidney me-
senchyme, and the genital bud. E proteins have recently been
considered redundant during brain development [Ravanpay and
Olson, 2008]. However, Tcf4 has recently been shown to play an
exclusive role in pontine neuron differentiation via heterodimeriza-
tion with Math1 (also known as Atoh1 and encoding a proneuronal
class II bHLH) [Flora et al., 2007]. These data demonstrate that
TCF4 is specifically required during brain development and sheds
light on the ventilatory and movement disorders observed in PHS
patients. Indeed, the pontine nucleus is involved in the central
autonomic pathway and in storing the memory of intention during
motor activity. Furthermore, Math1 is essential for intestinal
secretory cell differentiation and intestinal secretory cell production
in adult mice [Shroyer et al., 2007]. Although, Tcf4 has not
currently been shown to heterodimerize with Math1 in these cells
also, this could explain the intestinal dysfunction observed in the
vast majority of PHS patients. We show that TCF4 is expressed in
both enteric ganglia and epithelial crypt cells of the intestine.
Therefore, whether HSCR occurred by chance in one patient with
PHS or is a feature to be ascribed to TCF4 dysfunction [Peippo
et al., 2006] is not fully answered; PHS should still be considered for
patients presenting an unexplained combination of HSCR or severe
constipation and mental retardation.
Altogether, clinical, imaging, and immunological data identified
in PHS highlight the dose-sensitive and nonredundant functions
of E-proteins for normal development in humans.
Acknowledgments
We are grateful to Franc-ois Guillemot (National Institute for Medical
Research, Mill Hill, Londres) for providing luciferase reporter plasmids,
Candice Babarit for in situ hybridization, and Tania Attie´-Bitach for
helpful discussion. We thank the PHS families and their referring clinicians
for their participation. While the paper was under review, two series of
PHS cases have been published. This raises the number of PHS cases up to
50 [Giurgea et al., 2008; Zweier et al., 2008).
References
Amiel J, Rio M, de Pontual L, Redon R, Malan V, Boddaert N, Plouin P, Carter NP,
Lyonnet S, Munnich A, Colleaux L. 2007. Mutations in TCF4, encoding a class I
basic helix-loop-helix transcription factor, are responsible for Pitt-Hopkins
syndrome, a severe epileptic encephalopathy associated with autonomic
dysfunction. Am J Hum Genet 80:988–993.
Andrieux J, Lepretre F, Cuisset JM, Goldenberg A, Delobel B, Manouvrier-Hanu S,
Holder-Espinasse M. 2008. Deletion 18q21.2q21.32 involving TCF4 in a boy
diagnosed by CGH-array. Eur J Med Genet 51:172–177.
Bain G, Gruenwald S, Murre C. 1993. E2A and E2-2 are subunits of B-cell-specific
E2-box DNA-binding proteins. Mol Cell Biol 13:3522–3529.
Brockschmidt A, Todt U, Ryu S, Hoischen A, Landwehr C, Birnbaum S, Frenck W,
Radlwimmer B, Lichter P, Engels H, Driever W, Kubisch C, Weber RG. 2007.
Severe mental retardation with breathing abnormalities (Pitt-Hopkins syn-
drome) is caused by haploinsufficiency of the neuronal bHLH transcription
factor TCF4. Hum Mol Genet 16:1488–1494.
Castro DS, Skowronska-Krawczyk D, Armant O, Donaldson IJ, Parras C, Hunt C,
Critchley JA, Nguyen L, Gossler A, Gottgens B, Matter JM, Guillemet F. 2006.
Proneural bHLH and Brn proteins coregulate a neurogenic program through
cooperative binding to a conserved DNA motif. Dev Cell 11:831–844.
de Pontual L, Nepote V, Attie-Bitach T, Al Halabiah H, Trang H, Elghouzzi V,
Levacher B, Benihoud K, Auge J, Faure C, Laudier B, Vekemans, M, Munnich A,
Perricaudet M, Guillemot F, Galtier C, Lyonnet S, Simonneau M, Amiel J. 2003.
Noradrenergic neuronal development is impaired by mutation of the proneural
HASH-1 gene in congenital central hypoventilation syndrome (Ondine’s curse).
Hum Mol Genet 12:3173–3180.
Delous M, Baala L, Salomon R, Laclef C, Vierkotten J, Tory K, Golzio C, Lacoste T,
Besse L, Ozilou C, Moutkine I, Hellman NE, Anselme I, Sibermann F, Vesque C,
Gerhardt C, Rattenberry E, Wolf MT, Gubier MC, Martinovic J, Encha-Razavi F,
Boddaert N, Gonzales M, Macher MA, Nivet H, Champion G, Berthe´le´me´ JP,
Niaudet P, Mcdonald F, Hildebrandt F, Johnson CA, Vekemans M, Antignac C,
Ru¨ther U, Schneider-Mauoury S, Attie´-Bitach T, Seunier S. 2007. The ciliary
Figure 5. Expression of TCF4 in the small intestine at age 5. A: Myenteric ganglia (arrow) are colabeled (B) by CD56. C: Hematoxylin-eosin
stain of adjacent section. D: Paneth crypt cells (arrow) of the intestinal epithelium also express TCF4. E: These are colabeled by synaptotagmin.
F: Hematoxylin-eosin stain of adjacent section. Bar 40 mm.
HUMAN MUTATION, Vol. 30, No. 4, 669–676, 2009 675
Page 8
hidden
gene RPGRIP1L is mutated in cerebello-oculo-renal syndrome (Joubert
syndrome type B) and Meckel syndrome. Nat Genet 39:875–881.
Flora A, Garcia JJ, Thaller C, Zoghbi HY. 2007. The E-protein Tcf4 interacts with
Math1 to regulate differentiation of a specific subset of neuronal progenitors.
Proc Natl Acad Sci USA 104:15382–15387.
Gustavsson P, Kimber E, Wahlstrom J, Anneren G. 1999. Monosomy 18q syndrome
and atypical Rett syndrome in a girl with an interstitial deletion
(18)(q21.1q22.3). Am J Med Genet 82:348–351.
Giurgea I, Missirian C, Cacciagli P, Whalen S, Fredriksen T, Gaillon T, Rankin J,
Mathieu-Dramard M, Morin G, Martin-Coignard D, Dubourg C, Chabrol B,
Arfi J, Giuliano F, Claude Lambert J, Philip N, Sarda P, Villard L, Goossens M,
Moncla A. 2008. TCF4 deletions in Pitt-Hopkins ayndrome. Hum Mutat Epub
ahead of print.
Henthorn P, Kiledjian M, Kadesch T. 1990. Two distinct transcription factors that
bind the immunoglobulin enhancer microE5/kappa 2 motif. Science
247:467–470.
Kuiper RP, Schoenmakers EF, van Reijmersdal SV, Hehir-Kwa JY, van Kessel AG, van
Leeuwen FN, Hoogerbrugge PM. 2007. High-resolution genomic profiling of
childhood ALL reveals novel recurrent genetic lesions affecting pathways
involved in lymphocyte differentiation and cell cycle progression. Leukemia
21:1258–1266.
Murre C. 2005. Helix-loop-helix proteins and lymphocyte development. Nat
Immunol 6:1079–1086.
Orrico A, Galli L, Zappella M, Lam CW, Bonifacio S, Torricelli F, Hayek G. 2001.
Possible case of Pitt-Hopkins syndrome in sibs. Am J Med Genet 103:157–159.
Peippo MM, Simola KO, Valanne LK, Larsen AT, Kahkonen M, Auranen MP,
Ignatius J. 2006. Pitt-Hopkins syndrome in two patients and further definition
of the phenotype. Clin Dysmorphol 15:47–54.
Persson P, Jogi A, Grynfeld A, Pahlman S, Axelson H. 2000. HASH-1 and E2-2 are
expressed in human neuroblastoma cells and form a functional complex.
Biochem Biophys Res Commun 274:22–31.
Pitt D, Hopkins I. 1978. A syndrome of mental retardation, wide mouth and
intermittent overbreathing. Aust Paediatr J 14:182–184.
Ravanpay AC, Olson JM. 2008. E protein dosage influences brain development more
than family member identity. J Neurosci Res 86:1472–1481.
Revy P, Busslinger M, Tashiro K, Arenzana F, Pillet P, Fischer A, Durandy A. 2000.
A syndrome involving intrauterine growth retardation, microcephaly, cerebellar
hypoplasia, B lymphocyte deficiency, and progressive pancytopenia. Pediatrics
105:E39.
Ross SE, Greenberg ME, Stiles CD. 2003. Basic helix-loop-helix factors in cortical
development. Neuron 39:13–25.
Shroyer NF, Helmrath MA, Wang VY, Antalffy B, Henning SJ, Zoghbi HY. 2007.
Intestine-specific ablation of mouse atonal homolog 1 (Math1) reveals a role in
cellular homeostasis. Gastroenterology 132:2478–2488.
Singh HA. 1993. Mental retardation, macrostomia and hyperpnoea syndrome.
J Paediatr Child Health 29:156–157.
Van Balkom ID, Quartel S, Hennekam RC. 1998. Mental retardation, ‘‘coarse’’ face,
and hyperbreathing: confirmation of the Pitt-Hopkins syndrome. Am J Med
Genet 75:273–276.
Zhuang Y, Cheng P, Weintraub H. 1996. B-lymphocyte development is regulated by
the combined dosage of three basic helix-loop-helix genes, E2A, E2-2, and HEB.
Mol Cell Biol 16:2898–2905.
Zweier C, Peippo MM, Hoyer J, Sousa S, Bottani A, Clayton-Smith J, Reardon W,
Saraiva J, Cabral A, Gohring I and others. 2007. Haploinsufficiency of TCF4
causes syndromal mental retardation with intermittent hyperventilation
(Pitt-Hopkins syndrome). Am J Hum Genet 80:994–1001.
Zweier C, Sticht H, Bijlsma E, Clayton-Smith J, Boonen SE, Fryer A, Greally MT,
Hoffmann L, den Hollander NS, Jongmans M, Kant SG, King MD, Lynch SA,
McKee S, Midro AT, Park SM, Ricotti V, Tarantino E, Wessels M, Peippo M,
Rauch A. 2008. Further delineation of Pitt-Hopkins syndrome: phenotypic and
genotypic description of sixteen novel patients. J Med Genet Aug 2008;
doi:10.1136/jmg.2008.060129.
676 HUMAN MUTATION, Vol. 30, No. 4, 669–676, 2009

Sign up today - FREE

Mendeley saves you time finding and organizing research. Learn more

  • All your research in one place
  • Add and import papers easily
  • Access it anywhere, anytime

Start using Mendeley in seconds!

Already have an account? Sign in

Readership Statistics

5 Readers on Mendeley
by Discipline
 
 
by Academic Status
 
80% Ph.D. Student
 
20% Researcher (at an Academic Institution)
by Country
 
40% United Kingdom
 
40% United States
 
20% France