Neuropilin-1 Binds Vascular Endothelial Growth Factor 165,
Placenta Growth Factor-2, and Heparin via Its b1b2 Domain*
Received for publication, January 23, 2002, and in revised form, April 19, 2002
Published, JBC Papers in Press, May 1, 2002, DOI 10.1074/jbc.M200730200
Roni Mamluk‡§, Ze’ev Gechtman‡§¶, Matthew E. Kutcher‡, Nijole Gasiunas
, John Gallagher
,
and Michael Klagsbrun‡**‡‡
From the Departments of ‡Surgical Research and **Pathology, Children’s Hospital and Harvard Medical School,
Boston, Massachusetts 02115 and the
Cancer Research Campaign, Department of Medical Oncology,
University of Manchester, Christie Hospital, Manchester M20 4BX, United Kingdom
Neuroplin-1 (NRP1), a receptor for vascular endothe-
lial growth factor (VEGF) family members, has three
distinct extracellular domains, a1a2, b1b2, and c. To de-
termine the VEGF165 and placenta growth factor 2
(PlGF-2)-binding sites of NRP1, recombinant NRP1 do-
mains were expressed in mammalian cells as Myc-
tagged, soluble proteins, and used in co-precipitation
experiments with 125I-VEGF165 and
125I-PlGF-2. Anti-
Myc antibodies immunoprecipitated 125I-VEGF165 and
125I-PlGF-2 in the presence of the b1b2 but not of the
a1a2 and c domains. Neither b1 nor b2 alone was capable
of binding 125I-VEGF165. In competition experiments,
VEGF165 competed PlGF-2 binding to the NRP1 b1b2
domain, suggesting that the binding sites of VEGF165
and PlGF-2 overlap. The presence of the a1a2 domain
greatly enhanced VEGF165, but not PlGF-2 binding to
b1b2. Heparin enhanced the binding of both 125I-
VEGF165 and
125I-PlGF-2 to the b1b2 domain by 20- and
4-fold, respectively. A heparin chain of at least 20–24
monosaccharides was necessary for binding. In addi-
tion, the b1b2 domain of NRP1 could bind heparin di-
rectly, requiring heparin oligomers of at least 8 mono-
saccharide units. It was concluded that an intact b1b2
domain serves as the VEGF165-, PlGF-2-, and heparin-
binding sites in NRP1, and that heparin is a critical
component for regulating VEGF165 and PlGF-2 interac-
tions with NRP1 by physically interacting with both
receptor and ligands.
Neuropilins (NRPs)1 are 130–140-kDa cell surface glycopro-
teins that mediate neuronal guidance and angiogenesis (1).
There are two NRP genes, NRP1 and NRP2 (2, 3). NRP1 is
essential for normal development of the nervous and cardio-
vascular systems. Overexpression of NRP1 in mouse embryos
results in ectopic sprouting and defasciculations of nerve fibers
along with excess capillary growth and malformed hearts (4).
NRP1-deficient mice show severe neuronal abnormalities as
well as deficiencies in neuronal vascularization, aortic arch
malformations, and diminished and disorganized yolk sac vas-
cularization (5, 6). NRP1 also contributes to tumor angiogene-
sis. Induction of NRP1 expression in tumor cells in vivo results
in larger and more vascular tumors (7).
In the nervous system, NRP1 is expressed on axons of dorsal
root ganglia, as well as sympathetic and motor neurons as a
receptor for class 3 semaphorins (2, 8). Semaphorin 3A
(Sema3A) is a chemorepellant for axons and collapses their
growth cones (9). NRP1 is the binding receptor for Sema3A
however, Sema3A signaling is transduced by plexins. Plexins
are transmembrane kinases that do not bind Sema3A directly
but form a complex with NRP1 that enhances the binding of
Sema3A to NRP1 (10, 11).
In the vascular system, NRPs are the second class of vascu-
lar endothelial growth factor (VEGF) receptors to be described
(12, 13), the first being the receptor tyrosine kinases VEGFR1
(Flt-1), VEGFR2 (KDR/Flk-1), and VEGFR3 (Flt-4). NRP1 acts
as a co-receptor for VEGF165 activation of VEGFR2 (13). NRP1
also binds placenta growth factor 2 (PlGF-2), VEGF-B, and
VEGF-E (14–16).
Heparin and heparan sulfate (HS) play important roles in
mediating growth factor-receptor interactions, for example, the
binding of basic fibroblast growth factor, heparin-binding EGF-
like growth factor, and hepatocyte growth factor (17–19). The
heparin binding properties of VEGF have been well estab-
lished. All the VEGF isoforms are heparin-binding with the
exception of VEGF121, which lacks exons 6 and 7 that encode
the VEGF heparin-binding domains (20). VEGF165 interactions
with endothelial cells are mediated by heparin. In cross-linking
analysis, heparin potentiated the binding of VEGF165 to
VEGFR2 (21). Heparin was also shown to enhance the binding
of VEGF165 to a 130-kDa receptor (21, 22) that we subsequently
showed to be NRP1 (13). In a binding study using surface
plasmon resonance technology (BIAcore system), heparin in-
creased the affinity of VEGF165 for the immobilized NRP1
extracellular domain (23).
PlGF is a member of the VEGF family. Three PlGF iso-
forms were generated by mRNA alternative splicing (24, 25).
PlGF-2 is the only heparin-binding isoform (26). Interest-
ingly, the PlGF-2 isoform binds NRP1, whereas PlGF-1 binds
neither heparin nor NRP1. Moreover, PlGF-2 binding to
NRP1 is heparin/HS-dependent (14). PlGF binds and acti-
vates VEGFR1 but not VEGFR2. The role of VEGFR1 acti-
vation by PlGF in endothelial cells is not yet established.
Similarly, the significance of NRP1 as a PlGF-2 receptor is
unknown. NRP1 was shown to bind directly to VEGFR1, and
this interaction was competed by heparin (23). This is in
* The costs of publication of this article were defrayed in part by the
payment of page charges. This article must therefore be hereby marked
“advertisement” in accordance with 18 U.S.C. Section 1734 solely to
indicate this fact.
§ Both authors contributed equally to this work.
¶ Present address: Johnson & Johnson Pharmaceutical, Research
and Development, LLC, Raritan, NJ, 08869.
‡‡ To whom correspondence should be addressed. Tel.: 617-355-7503;
Fax: 617-355-7291; E-mail: michael.klagsbrun@tch.harvard.edu.
1 The abbreviations used are: NRP, neuropilin-1; PlGF-2, placenta
growth factor 2; VEGF, vascular endothelial growth factor; Sema3A,
semaphorin 3A; HS, heparan sulfate; HUVEC, human umbilical vein
endothelial cells; PAEC, porcine aortic endothelial cells; CM, condi-
tioned medium; FPLC, fast protein liquid chromatography; sNRP1,
soluble neurophilin-1.
THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 277, No. 27, Issue of July 5, pp. 24818–24825, 2002
© 2002 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A.
This paper is available on line at http://www.jbc.org24818

contrast to the potentiation of VEGF165/VEGFR2/NRP1 in-
teractions by heparin.
The structure of NRP1 may explain in part how NRP1 can
interact with multiple structurally unrelated ligands. NRP1
contains a relatively large extracellular domain of 860 amino
acids and a short cytoplasmic domain of 40 amino acids. The
extracellular part has 3 subdomains, designated a, b, and c.
The a and b domains consist of two tandem repeats, a1a2 and
b1b2. The c domain contains a MAM domain shown to be
involved in dimerization of proteins, such as the zinc-metallo-
proteinase meprins (27, 28). Precise identification of VEGF165-
and PlGF-2-binding sites on NRP1 and characterization of
their specific interactions with NRP1 could be of interest in
understanding structure-function relationships. In this report,
we have used soluble NRP1 extracellular domain fragments to
demonstrate that the NRP1 b1b2 domain is the binding site for
VEGF165 and PlGF-2; nevertheless, the two ligands differ in
their NRP1 b1b2 domain binding characteristics. Furthermore,
we demonstrate for the first time that the b1b2 domain is the
NRP1 heparin-binding domain and that heparin potentiates
VEGF/b1b2 interactions. We conclude that the b1b2 domain
serves as PlGF-2-, VEGF165-, and heparin-binding sites, that
this domain is central to NRP1/ligand interactions, and that
heparin plays an important role in regulating these
interactions.
EXPERIMENTAL PROCEDURES
Materials
VEGF165 was a gift from Dr. Judith Abraham Chiron (Emeryville,
CA). Materials were purchased from the following sources. Recombi-
nant mouse PlGF-2 was from R&D Systems (Minneapolis, MN); fetal
bovine serum, Dulbecco’s modified Eagle’s medium, F-12 medium, and
glutamine/penicillin/streptomycin mixture were from Invitrogen; anti-
Myc antibody clone 9E10 was from Santa Cruz Biotechnology (Santa
Cruz, CA); FuGENE 6 transfection reagent was from Roche Molecular
Biochemicals; pSecTag and Zeocin
were from Invitrogen; PfuTurboTM
DNA polymerase was from Stratagene (La Jolla, CA); protein G-Sepha-
roseTM and ConA-SepharoseTM were from Amersham Biosciences; hep-
arin-coated agarose beads and heparin were from Sigma; 125I-sodium
was from PerkinElmer Life Sciences; and heparin-TSK column was
from Toso-Haas (Japan).
Cell Culture
Human umbilical vein endothelial cells (HUVEC) were obtained
from Clonetics/BioWhittaker (Walkersville, MD) and grown according
to the manufacturer’s protocol in EGMTM medium. MDA-MB-231 cells
were obtained from the American Type Culture Collection (Manassas,
VA) and cultured in Dulbecco’s modified Eagle’s medium containing
10% fetal bovine serum and 1% glutamine/penicillin/streptomycin.
Chinese hamster ovary cells (CHO-K1) were obtained from ATCC and
cultured in F-12 medium with 10% fetal bovine serum and 1% gluta-
mine/penicillin/streptomycin. Porcine aortic endothelial cells (PAEC)
(13) were cultured in F-12 medium with 10% fetal bovine serum and 1%
glutamine/penicillin/streptomycin.
Cloning and Expression of Recombinant NRP1 Extracellular
Domains
Human NRP1 cDNA was used as a template for PCR amplification of
the domains described below. For in-frame cloning, an XhoI site was
added to all reverse primers at their 3
end. BamHI (for all constructs
containing the a1a2 domain) or HindIII sites were added to the 5
end
of the forward primers. The following primer pairs were used for PCR
amplification of NRP1 domains: a1a2 domain (Phe23-Phe273), 5
-CCT-
ACGGGATCCACGCAACGATAAATGTGG and 3
-CTCTAGACTCGA-
GGAAATCTTCTGAGACACTGCTCTG; b1b2 domain (Cys275-Ala587),
5
-CCTACGAAGCTTATGTATGGAAGCTCTGGGCATG and 3
-CTCT-
AGACTCGAGGGCTTCCACTTCACAGCCCAG; c domain (Gly647-C-
ys809), 5
-GGAAGCTTCGGTTTTAACTGTGAATTTGGC and 3
-AGAC-
TCGAGACAATCTTCTTGTGAAATGTG; a1a2/b1b2 domain (Phe23-A-
la587), 5
-CCTACGGGATCCACGCAACGATAAATGTGG and 3
-CTCT-
AGACTCGAGGGCTTCCACTTCACAGCCCAG; a1a2/b1 domain
(Phe23-Pro430), 5
-CCTACGGGATCCACGCAACGATAAATGTGG and
3
-CTCTAGACTCGAGAGGATAATCTGTTATCTTGCA; b1 domain
(Cys275-Pro430), 5
-CCTACGAAGCTTATGTATGGAAGCTCTGGGC-
ATG and 3
-CTCTAGACTCGAGAGGATAATCTGTTATCTTGCA; b2
domain (Cys431-Ala587), 5
-CCTACGAAGCTTATGCTCTGGAATGTTG-
GGTATG and 3
-CCTACGAAGCTTATGCTCTGGAATGTTGGGTATG.
PCR was carried out with PfuTurboTM DNA polymerase for 25 cycles:
95 °C for 30 s, 58 °C for 30 s, and 72 °C for 1–4 min in a Thermal
MastercyclerTM (Eppendorf Scientific, Westbury, NY). The integrity of
the amplified fragments was confirmed by sequence analysis. PCR
products were ligated into a pSecTag mammalian expression vector.
These plasmids were transiently transfected into PAEC using the Fu-
GENE 6 transfection reagent, and cells were allowed to recover for 24 h
in F-12 medium containing 10% fetal bovine serum. The following day,
cells were washed thoroughly and incubated for 48 h in serum-free
F-12. Serum-free conditioned media (CM) was used in all experiments
unless otherwise specified.
Purification of Recombinant Domain-specific Proteins
To produce pure recombinant proteins, pSecTag plasmids encoding
the various NRP1 domains were transfected into CHO-K1 cells using
the FuGENE 6 transfection reagent. Cells were selected with Zeocin
(0.5 mg/ml) for 12 days. Resistant clones were chosen and expanded,
and their CM were assayed for protein expression by Western blotting
using an anti-Myc antibody. Positive clones expressing the recombinant
proteins were expanded further. One stable clone representing each
NRP1 domain was used to condition 2 liters of serum-free medium.
Protein purification was carried out as previously described (29).
Briefly, CM was concentrated, adjusted to 20 mM Hepes, pH 7.2, 0.5 M
NaCl (concanavalin A binding buffer), and incubated with concanavalin
A beads overnight at 4 °C. Concanavalin A-binding proteins were eluted
with 0.2 M methyl-
-D-mannopyranoside and applied onto a 1-ml Hi-
Trap chelating column (Amersham Biosciences) loaded with cobalt and
attached to a Pharmacia FPLC system. Bound proteins were eluted by
a linear gradient of 5–150 mM imidazole. Fractions were analyzed for
the presence of recombinant domain protein by Western blot analysis
and Coomassie Blue staining following SDS-PAGE. Pooled fractions
were concentrated and adjusted to 20 mM Hepes, pH 7.2, 50 mM NaCl.
Protein concentrations were determined using the Bio-Rad protein as-
say (Bio-Rad).
Binding and Cross-linking of 125I-VEGF165 and
125I-PlGF-2 to
NRP1 Domains and Cells
Binding of VEGF to NRP1 Domains in Solution—VEGF165 and
PlGF-2 were iodinated as described (12). Five nanograms of 125I-
VEGF165 or
125I-PlGF-2 were incubated with pure NRP1 b1b2 or a1a2/
b1b2 domains or CM containing recombinant NRP1 domains (5–20
g/ml) adjusted to 20 mM Hepes, pH 7.4, 0.15 M NaCl, 0.1% Tween 20,
0.1% bovine serum albumin, with or without 1 g/ml unfractionated
heparin or heparin oligosaccharides for 2 h at 25 °C. Complexes were
incubated overnight with anti-Myc antibodies (1 g/tube), followed by
incubation for 1 h with protein G-Sepharose beads. Immunocomplexes
were washed three times with 20 mM Hepes, pH 7.4, 0.15 M NaCl, 0.1%
Tween 20, and bound 125I-VEGF165 was eluted by boiling the beads in
Laemmli’s sample buffer for 5 min. The samples were analyzed by 10%
SDS-PAGE followed by autoradiography. Aliquots of each sample of CM
were analyzed by Western blot with an anti-Myc antibody to verify that
equal amounts of NRP1 domains were being compared in the immuno-
precipitation experiments. For quantification of immunoprecipitated
125I-VEGF165 or
125I-PlGF-2, 3-l aliquots of each sample were meas-
ured in a -counter.
Cross-linking of VEGF165 or PlGF-2 to NRP1 Domains—Binding of
125I-VEGF165 or
125I-PlGF-2 to NRP1 recombinant domains was carried
out as described above. Complexes were cross-linked in 0.2 mM disuc-
cinimidyl substrate for 15 min, and the reaction was stopped by the
addition of 10 mM Tris, pH 7.4, 250 mM glycine, 2 mM EDTA. Complexes
were separated by 7.5% SDS-PAGE, and dried gels were
autoradiographed.
Competition of VEGF165 Binding to Cells by NRP1 Domains—Bind-
ing of 125I-VEGF165 to HUVEC and MDA-MB 231 cells was performed
as described (12). In competition experiments, 125I-VEGF165 (5 ng/ml)
and heparin (1 g/ml) were mixed with either CM containing recombi-
nant NRP1 domains or pure recombinant domains. Samples were pre-
incubated at 25 °C for 30 min prior to cell binding. Cell binding exper-
iments were carried out in 24-well plates in triplicate for 2.5 h on ice
with gentle agitation followed by 3 washes with ice-cold phosphate-
buffered saline. Cells were lysed with 0.2 N NaOH, and associated
radioactivity was measured with a -counter.
NRP1 b1b2 Domain Binds PlGF-2, VEGF165, and Heparin 24819