Memoirs of Museum Victoria 64: 35–52 (2007)
ISSN 1447-2546 (Print) 1447-2554 (On-line)
http://museumvictoria.com.au/Memoirs/
New Holothuria species from Australia (Echinodermata: Holothuroidea:
Holothuriidae), with comments on the origin of deep and cool holothuriids
P. M ARK O LOUGHLIN
1
, GUSTAV PAULAY
2
, DIDIER VANDENSPIEGEL
3
AND YVES SAMYN
4
1
Marine Biology Section, Museum Victoria, GPO Box 666, Melbourne, Victoria 3001, Australia (pmo@bigpond.net.au)
2
Florida Museum of Natural History, University of Florida, Gainesville FL 32611 7800, USA (paulay@ mnh.u .edu)
3
MusØe royal de l Afrique centrale, Section invertebrates non-insects, B-3080, Tervuren, Belgium (dvdspiegel@africamuseum.be)
4
Royal Belgian Institute of Natural Sciences, Global Taxonomy Initiative, B-1000, Brussels, Belgium (yves.samyn@naturalsciences.be)
Abstract O Loughlin, P. M., Paulay, G., VandenSpiegel D., and Samyn, Y. 2007. New Holothuria species from Australia
(Echinodermata: Holothuroidea: Holothuriidae), with comments on the origin of deep and cool holothuriids. Memoirs of
Museum Victoria 64: 35 52.
Two aspidochirotid species, new to science, from the continental slope of southern Australia are described:
Holothuria (Panningothuria) austrinabassa O Loughlin sp. nov. and Holothuria (Halodeima) nigralutea O Loughlin sp.
nov. The rst represents the southernmost documented holothuriid, and is the sister species of the northernmost holothuriid
species Holothuria (Panningothuria) forskali Delle Chiaje. The second is a very recent offshoot of the wide-ranging Indo-
west Paci c Holothuria (Halodeima) edulis Lesson. Morphological and molecular genetic differences between these
species pairs are detailed. Holothuria (Halodeima) signata Ludwig is raised out of synonymy with H. edulis.A lectotype
for Holothuria (Halodeima) signata Ludwig is designated, The status of the subgenera Panningothuria Rowe and
Halodeima Pearson is discussed. The occurrence of multiple madreporites in Halodeima is discussed.
Keywords Echinodermata, Holothuroidea, Holothuriidae, Holothuria, taxonomy, new species, new lectotypes.
Introduction
The Holothuriidae is one of the most diverse families of sea
cucumbers, with the bulk of this diversity in shallow, tropical
waters. Of the more than 185 species (Samyn et al., 2005)
currently recognized, all but a handful thrive in the tropics,
predominantly on coral reefs, at less than 50 m depths. It is
therefore noteworthy that recent surveys in Australia revealed
two new deepwater species from subtropical to warm temperate
latitudes. Specimens of the two new Holothuria species were
collected from the continental slope off western and south-western
Australia during the survey SS10/2005 by Australia s national
science agency, the Commonwealth Scienti c and Industrial
Research Organization (CSIRO), that is aiming to characterize
benthic ecosystems off Western Australia . This was commenced
through the Marine National Facility by the RV Southern Surveyor
in the last months of 2005. Additional specimens were discovered
in the collections of Museum Victoria. To ascertain the subgenera
to which the two new species belong, comparative morphological
and molecular studies were undertaken.
Methods
Genetic characterization was pursued by sequencing portions
of the mitochondrial 16S (large subunit) RNA and cytochrome
oxidase I (COI) genes. Ethanol- xed tissues of the new taxa,
related species, and outgroup taxa (see Table 1 for voucher
information) were macerated, digested in DNAzol
fi
and
proteinase K overnight, and genomic DNA isolated using
standard procedures (Meyer, 2003). Genomic DNA of most
samples was cleaned using the Qiagen polymerase chain
reaction (PCR) cleanup kit, following manufacturer s protocols,
except that cleaned DNA was resuspended in TE buffer. Qiagen
cleanup helped eliminate problems with inhibition prevalent in
holothurian samples.
An approximately 1120 bp long (1119 bp in H. nigralutea
G255) section of the large subunit of the mitochondrial ribosome
RNA gene (16S) was ampli ed with a pair of overlapping primers.
16Sc1 (TACCTT[T/G]TGTAT[T/A]ATGG[T/A]TTAAC ) and
16Sc2 (TGATTATGCTACCTTNGCAC) (designed new)
ampli ed 678 bp, and 16SAR (CGCCTGTTTATCAAAAACAT)
and 16SBR (GCCGGTCTGAACTCAGATCACGT) (Palumbi,
1996), ampli ed 510 bp in H. nigralutea (G255). A 651 bp length
of the mitochondrial cytochrome oxidase subunit 1 gene was
ampli ed with primers COIeF (ATAATGATAGGAGGRTTTGG)
COIeR (GCTCGTGTRTCTACRTCCAT) (Arndt et al., 1996).
PCR products were sequenced at the University of Florida s ICBR
center. Electropherograms were edited in Sequencher, aligned
with Clustal X, and adjusted by eye. Sequences are deposited in
GenBank (see Table 1 for GenBank and voucher information).
Sequence data from the two gene regions were analyzed as a

P. Mark O’Loughlin, Gustav Paulay, Didier VandenSpiegel and Yves Samyn36
single concatenated dataset. Parsimony trees were generated by
PAUP (version 4, Swofford, 2003), with 100 bootstrap replicates.
Bayesian analyses were run using Mr. Bayes (version 3.1.2,
Ronquist and Huelsenbeck, 2003), with MC
3
, GTR-I-Gamma, an
uninformative prior, for 10 million generations. GTR-I-Gamma
was chosen as the simplest model of evolution that tted the data,
using the Akaike Information Criterion as implemented by the
program Modeltest 3.6 (Posada and Crandall, 1998), for each
gene region as well as for the combined sequences. Indels were
included in the analysis. There was no evidence for pseudogene
sequences in any of several hundred specimens of Holothuria
sequenced to date; all reads were clean and unambiguous.
For scanning electron microscopy (SEM), ossicles were
cleared of associated soft tissues in commercial bleach. They
were then air-dried, mounted on aluminium stubs, coated
with gold, and observed with a JEOL JSM-6480LV scanning
electron microscope.
Abbreviations for institutions are: MNHN MusØe national
d Histoire naturelle, Paris; NMV Museum Victoria, Australia;
RBINS Royal Belgian Institute of Natural Sciences; UF
Florida Museum of Natural History; UH Zoologisches
Museum, Universitat Hamburg; UM University of Murcia,
Spain; USNM United States National Museum of Natural
History, Smithsonian Institution, Washington.
Specimen registration number pre xes are: MNHN EcHh;
NMV F; RBINS IG; UF E; UH E; UM HO; USNM E.
Table 1. Specimens sequenced. GenBank accession numbers given for gene regions.
Voucher Extraction Species Locality 16Sc 16SAR COIe
NMV F94742 N10 Stichopus ocellatus Papua New Guinea EU220793 EU220793 EU220814
UF E4834 G188 Actinopyga obesa Hawaii EU220794 EU220794 EU220815
UF E4901 N82 Bohadschia sp. nov. Hawaii EU220795 EU220795 EU220816
UF E1595 G80 H. excellens Palau EU220796 EU220796 EU220817
NMV F110524 G257 H. austrinabassa W Australia EU220797 EU220797 EU220818
UF E4480 G200 H. forskali Portugal EU220798 EU220798 EU220819
UF E4831 G186 H. atra Hawaii EU220799 EU220799 EU220820
UF E4460 G175 H. grisea Florida EU220800 EU220800 no
UF E3359 G247 H. kefersteini Panama EU220801 EU220801 no
UF E4877 G259 H. mexicana Belize EU220802 EU220802 EU220821
UF E4822 G230 H. oridana Florida EU220803 EU220803 EU220822
NMV F120437 N120 H. nigralutea W Australia EU220804 no EU220823
NMV F111290 G255 H. nigralutea W Australia EU220805 EU220805 EU220824
UF E3644 N3 H. edulis brown form Cocos-Keeling EU220806 EU220806 EU220825
UF E2065 J292 H. edulis typical form Oman EU220807 EU220807 EU220826
UF E4987 K140 H. edulis fuschia form Philippines EU220808 no EU220827
UF E4746 G104 H. edulis typical form Guam EU220809 EU220809 EU220828
UF E3884 J282 H. edulis grey form Okinawa EU220810 EU220810 EU220829
UF E3882 J296 H. edulis grey form Okinawa EU220811 EU220811 EU220830
UF E325 G50 H. signata Rangiroa EU220812 EU220812 EU220831
UF E329 G55 H. signata Rangiroa EU220813 EU220813 EU220832
Table 2. Characters distinguishing H. (Panningothuria) austrinabassa O Loughlin sp. nov. and H. (Panningothuria) forskali Delle Chiaje
Characters H. austrinabassa H. forskali
Body colour Grey-brown, small brown spots Black to dark brown
Papilla tubercles Distinct, ocellate, off-white Same colour as body wall
Tables in body wall Abundant, fully developed Sparse to absent, reduced form
Dorsal table discs > 50 m wide < 50 m wide
Spire of tables Always fully developed Rarely fully developed
Papillae rods Unbranched rods absent Unbranched rods present
Tentacle tables Present, reduced form Absent
Tube feet Spinous rods present Spinous rods absent
Distribution W and S Australia NE Atlantic, Mediterranean Sea