Sign up & Download
Sign in

Non-Invasive In Vivo Imaging of Calcium Signaling in Mice

by Kelly L Rogers, Sandrine Picaud, Emilie Roncali, Raphaël Boisgard, Cesare Colasante, Jacques Stinnakre, Bertrand Tavitian, Philippe Brûlet
PLoS ONE (2007)

Abstract

Rapid and transient elevations of Ca2+ within cellular microdomains play a critical role in the regulation of many signal transduction pathways. Described here is a genetic approach for non-invasive detection of localized Ca2+ concentration (Ca2+) rises in live animals using bioluminescence imaging (BLI). Transgenic mice conditionally expressing the Ca2+-sensitive bioluminescent reporter GFP-aequorin targeted to the mitochondrial matrix were studied in several experimental paradigms. Rapid Ca2+ rises inside the mitochondrial matrix could be readily detected during single-twitch muscle contractions. Whole body patterns of Ca2+ were monitored in freely moving mice and during epileptic seizures. Furthermore, variations in mitochondrial Ca2+ correlated to behavioral components of the sleep/wake cycle were observed during prolonged whole body recordings of newborn mice. This non-invasive imaging technique opens new avenues for the analysis of Ca2+ signaling whenever whole body information in freely moving animals is desired, in particular during behavioral and developmental studies.

Cite this document (BETA)

Available from www.pubmedcentral.nih.gov
Page 1
hidden

Non-Invasive In Vivo Imaging of Calcium Signaling in Mice

Non-Invasive In Vivo Imaging of Calcium Signaling in
Mice
Kelly L. Rogers
1,2¤
, Sandrine Picaud
1
, Emilie Roncali
2
, Raphae¨l Boisgard
2
, Cesare Colasante
1
, Jacques Stinnakre
1
, Bertrand Tavitian
2
,
Philippe Bruˆlet
1
*
1 Unite´ d’Embryologie Mole´culaire, CNRS URA 2578, Institut Pasteur, Paris, France, 2 CEA, Service Hospitalier Fre´de´ric Joliot, Inserm, U 803, Imagerie de
l’expression des ge`nes, Orsay, France
Rapid and transient elevations of Ca
2+
within cellular microdomains play a critical role in the regulation of many signal
transduction pathways. Described here is a genetic approach for non-invasive detection of localized Ca
2+
concentration ([Ca
2+
])
rises in live animals using bioluminescence imaging (BLI). Transgenic mice conditionally expressing the Ca
2+
-sensitive
bioluminescent reporter GFP-aequorin targeted to the mitochondrial matrix were studied in several experimental paradigms.
Rapid [Ca
2+
] rises inside the mitochondrial matrix could be readily detected during single-twitch muscle contractions. Whole
body patterns of [Ca
2+
] were monitored in freely moving mice and during epileptic seizures. Furthermore, variations in
mitochondrial [Ca
2+
] correlated to behavioral components of the sleep/wake cycle were observed during prolonged whole
body recordings of newborn mice. This non-invasive imaging technique opens new avenues for the analysis of Ca
2+
signaling
whenever whole body information in freely moving animals is desired, in particular during behavioral and developmental
studies.
Citation: Rogers KL, Picaud S, Roncali E, Boisgard R, Colasante C, et al (2007) Non-Invasive In Vivo Imaging of Calcium Signaling in Mice. PLoS
ONE 2(10): e974. doi:10.1371/journal.pone.0000974
INTRODUCTION
Calcium (Ca
2+
) is a universal second messenger that regulates cell
signaling pathways involved in muscular contraction, hormone
secretion, neurotransmitter release, cellular metabolism, apoptosis,
etc. Abnormalities in the homeostatic regulation of Ca
2+
signaling
have pathological consequences relevant to many common
diseases (e.g. Alzheimer’s, diabetes, cancer, migraine, cardiovas-
cular disorders) [1–4].
The selective regulation of many signal transduction pathways is
partly facilitated by intracellular Ca
2+
concentration ([Ca
2+
]) rises
that are restricted in space (e.g. nano- & micro-domains),
amplitude (100 nM–100’s mM) and time (microseconds to
seconds). The propagation of Ca
2+
waves or other second
messengers associated with Ca
2+
signaling may also affect remote
cellular regions, tissues, or other parts of an organism. In addition,
Ca
2+
oscillations of varying frequencies are important for gene
expression and other rhythmic activities [1,5].
In keeping with the versatile nature of Ca
2+
signals (e.g.
localization, amplitude, kinetics and frequency), optical imaging
methods can provide the high degree of spatio-temporal resolution
necessary for their characterization. Recently, these methods have
been extended to in vivo approaches allowing [Ca
2+
] within the
intact animal to be investigated under more physiological
conditions [6–9]. Notably, in vivo imaging of the neonatal brain
by fiber-optic based detection of Ca
2+
sensitive dyes, led to the
identification of early network Ca
2+
oscillations (ENOs) occurring
in the cortex of newborn mice during sleep [9]. In another
approach, a genetically encoded Ca
2+
sensitive probe was
expressed in the muscles of live animals and gave accurate
information about [Ca
2+
] in the mitochondrial matrix ([Ca
2+
]
m
)
during relaxation/contraction cycles [8]. However, all of these
methods are invasive and restricted to small fields of view (ca.
1mm
2
), preventing longitudinal analyses or studies on Ca
2+
signals
over long distances and simultaneously across multiple systems.
Bioluminescent probes in which light is produced by enzymatic
breakdown of a substrate have an excellent signal-to-noise ratio
(i.e. background noise is limited to that of the light detector). In
recent years, whole animal bioluminescence imaging (BLI) has
emerged as a sensitive method for localizing gene expression or
cell migration in live animals [10–12]. GFP-aequorin (GA) is
a bioluminescent Ca
2+
-reporter, which is based on the light
emitting system of the jellyfish, Aequorea victoria [13]. Upon Ca
2+
binding, aequorin undergoes a conformational change that
oxidizes its substrate coelenterazine (CLZN) and chemilumines-
cence resonance energy transfer (CRET) to the GFP moiety
occurs, with an emission maximum in the green (l = 510 nm). GA
has a low Ca
2+
binding affinity, large dynamic range of light
emission, is stable and has little, if any, toxicity, making it
a potentially useful reporter for application in BLI studies [13,14].
Here, we report transgenic mice expressing a subcellularly
targeted GA construct that allows non-invasive whole animal
imaging of [Ca
2+
]
m
. Monitoring [Ca
2+
]
m
can provide precise
information about the role of Ca
2+
signaling in biological
processes, such as apoptosis and the metabolic regulation of
cellular respiration [15,16]. We demonstrate that Ca
2+
-induced
light emission of GA from this compartment can be non-invasively
monitored with high sensitivity and over a wide temporal range
from 40 milliseconds to hours. Whole body optical imaging of
Academic Editor: Scott Fraser, California Institute of Technology, United States of
America
Received June 12, 2007; Accepted September 5, 2007; Published October 3, 2007
Copyright:  2007 Rogers et al. This is an open-access article distributed under
the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the
original author and source are credited.
Funding: The work was funded by Institut Pasteur, CNRS and AFM to PB and by
E.U. support through the EMIL and DIMI European Networks to BT. KR received
support from Institut Pasteur, CNRS and INSERM. Biospace Lab provided a PhD
scholarship to ER. CC was supported by CNRS.
Competing Interests: The authors have declared that no competing interests
exist.
* To whom correspondence should be addressed. E-mail: pbrulet@pasteur.fr
¤ Current address: Plate-forme d’Imagerie Dynamique (PFID), Institut Pasteur,
Paris, France
PLoS ONE | www.plosone.org 1 October 2007 | Issue 10 | e974
Page 2
hidden
newborn mice identified variations in [Ca
2+
]
m
that correlate to the
ontogeny of sleep/wake cycles and motor coordination. The
method offers large imaging fields of view, while details about the
regulation of [Ca
2+
] in subcellular compartments can be inferred
from the genetic targeting. This non-invasive approach should
therefore give new insight about Ca
2+
signaling in developmental
and behavioral studies, and in mitochondrial disorders linked to
muscle and nervous diseases.
RESULTS
Genetic targeting for analysis of local Ca
2+
signals
Transgenic mice were generated with a mitochondrially targeted
GFP-aequorin (mtGA) transgene. The transcription unit was
introduced by knock-in to the Hypoxanthine Phosphorylated
Ribosyl Transferase (hprt) locus on the X chromosome [17]. mtGA
contains the targeting sequence of subunit VIII of cytochrome c
oxidase for localization in the mitochondrial matrix [18].
Expression of the reporter was made conditional by using a lox
stop lox sequence 39 to the strong ubiquitous promoter, CAG
(Figure 1A). With a conditional Cre- loxP system, transcription of
the transgene can be genetically activated in specific cells at
a precise moment during embryogenesis or adult life.
Transgenic mice carrying the mtGA transgene were crossed with
a PGK-Cre mouse line, in order to activate ubiquitous expression
of the transgene from early stages of embryogenesis [19]. No
change in phenotype was observed in the resulting transgenic
mice. Western blot analysis in enriched mitochondrial fractions
from skeletal muscle reveals a band at 50 kDa corresponding to
the calculated molecular weight of the hybrid protein, GFP-
aequorin (Figure 1B). Fluorescence detection of GFP in whole
animals and tissues ex vivo shows that mtGA is expressed in
mitochondria of major organs with a high level of expression (data
not shown). Direct visualization of GFP fluorescence in fresh or
fixed tissue shows expression of the reporter protein in muscle
fibers of the tibialis anterior muscle (Figure 1C–1F). Electron
micrographs of immunogold cytochemistry performed on skeletal
muscle confirms that GFP immunoreactivity is found inside
mitochondria (92.362.56 %, n = 52) (Figure 1G–1I). Finally, the
ratio of light intensity at the emission maximum of the acceptor,
the GFP moiety (510 nm), to that of the donor, the aequorin
moiety (470 nm), was determined in enriched mitochondrial
populations obtained from the skeletal muscle, heart and brain
of transgenic animals (Figure 1J). The results clearly show that the
optical signals originate from GFP, and that aequorin and GFP are
in close enough proximity to allow transfer of the excited-state
energy by CRET [13,20] (Figure 1K), thus confirming the
presence and localization of the hybrid protein in tissue from
transgenic animals.
Ca
2+
signaling in neonatal neural tissues
Two-photon imaging of acute brain slices from newborn rats
previously revealed large-scale, highly synchronized early network
Ca
2+
oscillation waves (ENOs) in the developing neocortex [21].
ENOs were reported in the cytosolic compartment. In other
experimental systems, Ca
2+
oscillations in the cytosol have been
reported to occur in synchrony with [Ca
2+
] changes in the
mitochondrial matrix [22–25]. It was therefore determined if
[Ca
2+
]
m
oscillations could be detected in acute slices prepared
from the neonatal mtGA mouse brain. For the Ca
2+
dependent
CRET reaction to occur, the genetically expressed mtGA must be
reconstituted with the aequorin substrate, CLZN (mtGA-CLZN).
As described in previous studies [14], slices were first incubated
with CLZN and then observed with a highly sensitive bio-
luminescence microscopy system. Using this approach, oscillations
in [Ca
2+
]
m
were detected in both the cortex and hippocampus of
acute brain slices prepared from 0 to 2 day old newborns
(Figure 2A (i) & (ii), n = 3).
These Ca
2+
events decreased in frequency or were absent in
brain slices from older animals (P4–P12) (data not shown).
However, highly synchronized large-scale oscillations could be
induced in brain slices from P4–P12 mice by lowering the external
concentration of Mg
2+
(Figure 2B (i)–(iii), n = 25) or by addition of
bicuculline (10 mM) (data not shown). Blockade of Na
+
-channels
with tetrodotoxin (TTX, 0.5 mM) (Figure 2B (i), n = 3), completely
abolished the [Ca
2+
]
m
oscillations, suggesting that they depend on
neuronal activity. In addition, oscillations induced by low Mg
2+
were reversibly blocked by the NMDA receptor antagonist, D-
APV (50 mM), while those induced by bicuculline were reduced by
both D-APV and the antagonist for AMPA receptors, CNQX
(2 mM) (data not shown). Oscillatory rises in Ca
2+
were absent or
significantly reduced after incubation with the NADH-ubiquinone
oxidoreductase (complex I) inhibitor, piericidin A (2 mM)
(Figure 2C, n = 2) or FCCP (2 mM) (Figure 2D, n = 3), confirming
the mitochondrial origin of these responses.
Validation of BLI as an imaging modality for in vivo
detection of Ca
2+
transients during muscle
contraction
Skeletal muscle contraction is initiated by the release of Ca
2+
from
the sarcoplasmic reticulum (SR), which is rapidly sequestered by
mitochondria [8,26]. In subsequent studies, we investigated if
Ca
2+
-responses associated with contraction of the hindlimb
muscles could be detected within intact tissues of adult mice. In
these studies, CLZN was introduced via a tail-vein injection of the
substrate. We found that tetanic stimulation of the sciatic nerve in
mice bearing mtGA-CLZN, lead to a rapid increase in light
emission in the hindlimb muscles (5 ms pulses, 50 Hz, 2.5 s train
duration) (Figure 3A and Movie S1). In contrast, no increase in
light was ever detected in wild-type mice that had been injected
(i.v.) with CLZN and subjected to the same stimulation protocols
(data not shown).
Other studies reporting whole animal bioluminescence imaging
of gene expression with Renilla luciferase, indicate that CLZN has
limited access to some tissues and that it can be unstable in
biological media [27–29]. The time course for formation of the
mtGA-CLZN complex was examined by monitoring the muscle
signal triggered by nerve stimulation at repeated time intervals
after tail-vein (i.v.) injection of CLZN in mice. The time required
for the CRET signal to reach maximum amplitude following
CLZN injection ranged between 15 and 35 min (n = 4 mice, see
Figure 3B for an example). The light responses showed a high
degree of reproducibility after repetitive tetanic stimulations and
contraction/relaxation cycles in the hindlimb muscles. Remark-
ably, [Ca
2+
]
m
transients corresponding to tetanic contraction of
the hindlimb muscle could be detected for up to 100 stimulations
over a 1–2 hour period (Figure 3C (i)), and their amplitude and
kinetic profiles were essentially constant (Figure 3C (ii), n = 104).
Similar optical signals were recorded when the same mouse was
re-injected with CLZN on different days. Intramuscular injection
of Ru360, a specific inhibitor of mitochondrial Ca
2+
uptake,
attenuated Ca
2+
rises evoked by tetanic stimulation (70 Hz) of the
sciatic nerve (Figure 3D (i) & (ii)).
[Ca
2+
]
m
is known to be involved in the regulation of oxidative
phosphorylation and apoptosis, but its role in skeletal muscle
function is still largely unknown [16]. A recent study by Rudolf et
al. characterized changes in [Ca
2+
]
m
during contraction of skeletal
Live Animal Ca2+ Imaging
PLoS ONE | www.plosone.org 2 October 2007 | Issue 10 | e974
Page 3
hidden
Figure 1. Transgenic mice constructed with Cre-inducible, mitochondrially targeted GFP-aequorin. (A) Schematic diagram showing the genetic
design of transgenic animals. The transgene, pCAG-loxP-Stop-loxP-mtGA-PolyA can be activated by crossing mice with another mouse line expressing
Cre under the control of different promoters for conditional activation of mtGA transcription. (B) Western blot on purified mitochondrial enriched
fractions from skeletal muscle of transgenic mice crossed with PGK-Cre. Mitochondrial fractions were compared with transgenic mice, which were not
expressing the mtGA protein and blots were developed with both aequorin and GFP antibodies. (C, D, E, F) Confocal analysis of mtGA fluorescence in
anterior tibialis muscle fibers. (C and D) Direct fluorescence of GFP expression. (D) Enlargement of the frame area in C. (E and F) Overlay of anti-GFP
labeling (green) and anti-cytochrome-C labeling (red), where yellow indicates co-localization of the two labels. (F) Enlargement of the frame area in E.
Scale bars for C & E = 20 mm. Scale bars for D & F = 5 mm. (G–I). Gallery of post-embedding GFP immunogold electron micrographs from anterior
tibialis mouse muscle. GFP is localized in mitochondria. GFP is visualized by sequential probing with anti-GFP antibody and IgG conjugated with
10 nm colloidal gold. Scale bars: G, 1 mm; H, 500 nm; I, 100 nm. (J) Ca
2+
CRET activities on purified mitochondrial fractions from skeletal muscle, brain,
heart and cellular extracts. CRET measurements are expressed as the ratio of green (515 nm) over blue (460 nm). (K) Schematic diagram of the GA-
CLZN light reaction. The binding of Ca
2+
-ions to aequorin leads to a conformational change, which results in the oxidation of its bound substrate
chromophore, coelenterazine. Non-radiative energy transfer then occurs from the excited state chromophore to GFP, which then emits light in the
green (lmax = 510 nm).
doi:10.1371/journal.pone.0000974.g001
Live Animal Ca2+ Imaging
PLoS ONE | www.plosone.org 3 October 2007 | Issue 10 | e974
Page 4
hidden
muscle fibers expressing the Ca
2+
-sensitive fluorescent protein,
yellow cameleon (YC2) [8]. They used two-photon microscopy to
record cytosolic and mitochondrial Ca
2+
-responses with good
spatial resolution in intact tibialis anterior muscle fibers, in situ.
Applying the same protocols for stimulation of the sciatic nerve as
Rudolf et al., we obtained comparable results with BLI. However,
in our studies we monitored light responses from the entire
hindlimb muscle (or at least a large number of fibers from that
muscle) using a larger field of view and a lower spatial resolution.
10 s trains of stimuli were applied every 60 s to the sciatic nerve at
different frequencies (1–50 Hz) (Figure 4A–4D, n = 4 mice).
Results show that mitochondrial Ca
2+
uptake/release during
single twitch muscle contractions (1 Hz) can be recorded in vivo,
with a time resolution down to 40 ms (Figure 4A). The recorded
light responses were well correlated to different frequencies of
sciatic nerve stimulation (1–10 Hz). Furthermore, when the mean
light intensity was plotted after applying a train of stimuli at 1 Hz,
the profiles of the corresponding Ca
2+
-transients were highly
reproducible (Figure 4B, n=35, 4 mice). The intensity of the
muscle contraction, i.e. the number of muscle fibres recruited, also
increased with an increased stimulation voltage and there was
a strong correlation between the mean light intensity and the peak
amplitude of the electromyogram (Figure 4C). This is in line with
in vitro studies, which suggest that mitochondrial Ca
2+
uptake is
quantitatively correlated to the force of the muscular contraction
[30]. Differences in the intensities of light emission were also
correlated to the frequency of sciatic nerve stimulation (Figure 4D
(i)–(iv)). Overall, our data for muscle contraction confirm the
results of previous studies, validating this completely non-invasive
method as suitable for functional imaging of Ca
2+
responses during
studies on muscle contraction.
Periodic variations in mitochondrial [Ca
2+
] in whole
body imaging of newborn mice
In subsequent studies, [Ca
2+
]
m
responses associated with move-
ment were recorded in non-anaesthetised and unrestrained freely
moving CLZN-injected newborn mice (Figure 5A, (n = 6)) using an
imaging system that allows co-registration of the video and
bioluminescent images. Three major behavioral states, corre-
sponding to the known components of sleep/wake cycles, were
identified: (i) whole body startles and myoclonic twitches (see
Figure 2. Large-scale mitochondrial Ca
2+
signaling oscillations in acute brain slices from neonates. (A) Acute brain slices were prepared from
newborn mice and prolonged recordings of bioluminescence activity was detected by microscopy in large scale areas (600 mm
2
) of the cortex. Traces
represent 1500 s of data (1 s integration) obtained in the (i) temporal cortex of a horizontal brain slice from a 2 day old mouse and (ii) somatosensory
cortex of a coronal slice from a 1 day old mouse. (B) Epileptiform activity induced by low Mg
2+
in an acute coronal slice from a 10 day old mouse
brain. Recording was undertaken in the somatosensory cortex. (B (i)) Low Mg
2+
induced oscillations are blocked completely by TTX (500 nM, n =3)
and are absent in the presence of normal ACSF containing 1.3 mM MgCl
2
. Data in the trace is plotted with 1 s integrals. (B (ii) & (iii)) Expanded time
scales at the times indicated in B (i) & B (ii), respectively. Data is plotted with 50 ms integrals. Low Mg
2+
-induced mitochondrial Ca
2+
-transients are
blocked by (C) piericidin A (2 mM) and (D) FCCP (2 mM).
doi:10.1371/journal.pone.0000974.g002
Live Animal Ca2+ Imaging
PLoS ONE | www.plosone.org 4 October 2007 | Issue 10 | e974
Page 5
hidden
Movie S2 for an example), (ii) coordinated movements (see Movie
S3 for an example) and (iii) atonia (Figure 5B). In sleep/wake
cycles of newborn rats or mice, myoclonic twitching is the most
reliable way to identify the presence of active sleep [31,32]. In line
with the data from contraction/relaxation cycles of the hindlimb
muscle, whole body startles or muscular twitches identified in the
video recordings were correlated to fast Ca
2+
-transients having
short durations (,1 s) (Figure 5A & 5B (i)). In contrast,
coordinated movements were made up of sustained Ca
2+
rises
occurring across large scale areas of the body (Figure 5A & B (ii)).
In further studies, bioluminescence was monitored in newborn
animals over longer recording durations (1–1.5 hours). Similarly to
studies on the hindlimb muscle, signal was detectable within
15 minutes, and for up to 10 hours after i.p. injection in pups that
had been returned to their litter (n = 6). Variations in [Ca
2+
]
m
detected from whole body recordings of newborn mice had distinct
patterns (Figure 6A). Whole body Ca
2+
-response patterns were
observed to be made up of two major forms (a) fast Ca
2+
transients
having short durations of 100’s of ms to 1 s, which were
predominant (Figure 6 A(ii)) and (b) sustained Ca
2+
responses
(.1 s) (Figure 6A (i) & (iii)). Based on the observed patterns, we
separated newborn animals into two groups, one group of P0–1
(n = 9) and another group of P1–3 (n = 8). Sustained Ca
2+
responses had highly variable durations in both groups (.1–
200 s) (Figure 6B (i) & (iii)). In addition, fast Ca
2+
transients were
often observed to precede sustained responses (see Figure 6B (i) for
example). In some cases, sustained responses were observed to
occur across the entire body in a coordinated fashion (Figure 6 C
Figure 3. In vivo visualization of mitochondrial Ca
2+
uptake in the hindlimb muscle after stimulation of the sciatic nerve. (A) Direct visualization
of Ca
2+
-induced bioluminescence in the hindlimb muscle after tetanic stimulation of the sciatic nerve (5 ms pulses at 50 Hz for 2.5 s). Each frame
represents 1 s of light accumulation superimposed with the video image taken before the acquisition of bioluminescence. The FOV was 16612 cm.
Smoothing has been applied to the bioluminescent image overlay to a resolution of 1 mm. Color scale is in photons/pixel/s. (B) Mice were injected
(i.v) with native coelenterazine (4 mg/kg) and Ca
2+
-induced light emission was recorded immediately after in the hindlimb muscles in response to
tetanic stimulations applied every 2 minutes over more than 1.5 hours. The plot shows the increasing amplitude of the light response (photons/s) as
a function of time. (C (i) & (ii)) Ca
2+
-induced light emission was investigated in mice previously injected with CLZN by tail-vein and then stimulated (as
described above) every 30 s for up to 1 hour, (i) Graph showing the light emission (photons/s) during repetitive nerve stimulations and contraction/
relaxation cycles of the hind-limb muscle in a single mouse, (ii) The average light emission (photons/s) of the Ca
2+
transients shown in Figure C (i)
(n=104). The grey horizontal bar shows the time of the stimulus. (D (i) & (ii)) Trains of pulses (0.4 ms pulse duration at 70 Hz, train duration = 600 ms)
were applied every 30 seconds to the sciatic nerve. Total light intensity (photons/s) was plotted over time. The graphs show the amplitude of the
response (i) before, and (ii) after an intramuscular injection of Ru360 (500 mM).
doi:10.1371/journal.pone.0000974.g003
Live Animal Ca2+ Imaging
PLoS ONE | www.plosone.org 5 October 2007 | Issue 10 | e974
Page 6
hidden
&D,n = 4). The mean interval between fast Ca
2+
transients and
sustained responses was not significantly different between the two
groups (Figure 6E). However, animals from the group at P0–P1,
had sustained responses with durations that were approximately
half as long (9.861.2 s, n = 9 mice, 149 events) compared to older
P1–P3 animals (20.265.0 s, n = 8 mice, 151 events) (Figure 6F).
Sustained Ca
2+
responses in the older animals also had more
complex patterns (see Figure 6B (i) versus 6B (iii)). Overall, the
percentage of time recorded in the absence of sustained Ca
2+
responses was 88.563.5 % (n = 9) and 76.963.5 % (n = 8) for P0–1
and P1–3, respectively (Figure 6G). Recent studies using fiber
optics implanted in the cortex of non-anaesthetised newborn mice
showed that spontaneous and synchronized ENOs occur in the
cortex during intermittent sleep-like periods, which are absent
during motion [9]. In addition, in vitro studies on acute brain slices
confirm that spontaneous and experimentally induced Ca
2+
transients are readily detectable in neural tissues from the mtGA
mouse (Figure 2). However, we did not detect CRET signals from
Figure 4. In vivo detection of Ca
2+
transients during single twitch and tetanic contractions of the muscle. Trains of stimuli at different frequencies
were applied to the sciatic nerve and mitochondrial Ca
2+
uptake was monitored in the hindlimb muscle using an acquisition rate of 25 Hz. (A) Graphs
showing light emission detected from the muscle after trains of stimuli (10 s duration) were applied to the sciatic nerve at 1, 5 and 10 Hz. The data at
each time point on the graph represents 40 ms integrals. (B) The average light emission of Ca
2+
-transients plotted with 40 ms integration during
single-twitch muscle contractions (1 Hz stimulation) (n = 35, 4 mice). Error bars show6s.e.m. (C) Plot of the variation of the peak amplitude
electromyogram versus the maximum light intensity when varying the stimulation voltage. (D) Bioluminescence superimposed with the video image
of a transgenic mouse hindlimb after stimulation of the sciatic nerve at (i) 1 Hz, (ii) 5 Hz, (iii) 10 Hz and (iv) 50 Hz. The FOV was 16612 cm. Smoothing
has been applied to the bioluminescent image overlay to a resolution of 1 mm. Color scale is in photons/pixel/s.
doi:10.1371/journal.pone.0000974.g004
Live Animal Ca2+ Imaging
PLoS ONE | www.plosone.org 6 October 2007 | Issue 10 | e974
Page 7
hidden
the brain of newborn mice administered with CLZN, neither by
i.p. injection (n = 3), nor when the substrate was directly injected
into the brain (n = 3).
In vivo detection of bi-laterally synchronized Ca
2+
responses during seizures
We next investigated if Ca
2+
-transients could be detected during
kainate-induced seizure in non-anaesthetised 6–7 day old mice.
Imaging was started immediately after i.p. injection of kainic acid
(25 mg/Kg) and was continued for up to 1 hour. In the sequence
of images shown (Figure 7A and Movie S4), the dynamic patterns
of Ca
2+
distribution recorded reveal a remarkable profile of the
mouse undergoing a seizure, characterized by clonic movements
of the forelimbs [33]. The recorded photon flux in selected regions
of interest plotted as a function of time indicates that a marked
increase in [Ca
2+
] levels occurred in all areas approximately
15 minutes after drug administration (Figure 7B & C). Elevated
Ca
2+
activity appeared both as a slow rise in the basal
concentration and as oscillations in which Ca
2+
spikes only lasted
a few seconds (Figure 7B & C, (ii) & (iii)). Based on other studies,
kainate receptors are not only present in the brain, but also in the
spinal cord, adrenal glands, testis and the gastroenteropancreatic
system [34,35]. Analysis of several regions of interest indicated that
highly synchronized, bi-lateral Ca
2+
transients also occurred in
a spatially localized region on the dorsal side of this animal (see
Figure 7C (i)–(iii)). These Ca
2+
transients were faster than those
accompanying coordinated muscle movements and they may
therefore be linked to adrenal activity, which is expected to be high
during states of stress. Some of the signals were also synchronized
along the dorso-ventral axis. Hence, signal transduction can be
monitored along the rostro-caudal, dorso-ventral and lateral axes
in whole living animal models of epilepsy. Finally, using
bioluminescence for imaging over long periods can also reveal
other interesting phenomena, such as Ca
2+
waves occurring across
the entire animal, which were observed after kainate induced
seizures (Figure 7D (n = 5) and Movie S5).
DISCUSSION
A challenge in biology is to monitor signal transduction in a bona fide
physiological context, i.e. in live, un-restrained and non-anaesthe-
tised animals. Our objective here was to develop an approach
allowing non-invasive in vivo detection of local Ca
2+
-signaling in
freely moving animals. A genetic approach was chosen because it
allows specific in vivo targeting, endowing optical signals with a precise
knowledge of their origin even when detection takes place from
outside of the living animal. In previous studies we showed that the
Ca
2+
-sensitive genetically encoded bioluminescent protein GFP-
aequorin, could be expressed in several organelles such as the
mitochondrial matrix for detection of localized [Ca
2+
]incells[14].
Here, we demonstrate that GFP-aequorin, targeted to the
mitochondrial matrix, can also be stably expressed in transgenic
animals at all stages of development. Monitoring mitochondrial
[Ca
2+
] will enable the role of this compartment to be examined in
physiological processes (e.g. biological rhythms, learning & memory,
ageing, energy metabolism & apoptosis) and in pathological
conditions (e.g. excitotoxicity and metabolic disorders).
Figure 5. Distinct mitochondrial Ca
2+
responses in newborn mice are linked to different behavioral states. A newborn mouse (P1) was injected
(i.p.) with coelenterazine and whole animal bioluminescence was co-registered with the video image with an acquisition rate of 25 Hz using the
Video Imager. (A) Graph shown in black is the total light intensity (photons/s) detected during more than 700 s of recording. The thin grey line
running through the graph shows the minimum threshold set for scoring Ca
2+
-responses whose amplitudes reach or go above this limit. The upper
blue graph shows the cycling between motion and rest, which was determined by visual analysis of the video frames. Closed black arrow heads show
where fast Ca
2+
-transients (,1 s duration) are correlated to muscular twitches or whole body startles. Sustained Ca
2+
-responses (.1 s duration) are
associated with coordinated movements. The lower grey bar shows periods of baseline Ca
2+
activity (below the threshold line set) together with
black bars that represent the Ca
2+
-responses and their durations. (B) Examples of the three behavioral states visually characterized; including (i) whole
body startle, (ii) co-ordinated movement and (iii) atonia. Data for each state represents the video image superimposed with the bioluminescence
image at the times indicated on each frame and in Figure 5A. (i). Frames represent 40 ms integration of the bioluminescence superimposed to the
corresponding video image. Color scale is 0.000725–0.00145 photons/pixel (5 mm smoothing has been applied). (ii & iii) represents 160 ms
integration of the bioluminescence superimposed to the corresponding video frame. Color scale is 0.00174–0.00377 photons/pixel (3.5 mm
smoothing). The FOV used in these studies was 866 cm.
doi:10.1371/journal.pone.0000974.g005
Live Animal Ca2+ Imaging
PLoS ONE | www.plosone.org 7 October 2007 | Issue 10 | e974
Page 8
hidden
Figure 6. Variations in mitochondrial [Ca
2+
] are related to behavior in newborn mice. Newborn mice expressing mtGA were injected (i.p.) with
native coelenterazine and bioluminescence activity was recorded in un-restrained and freely moving newborns. (A) Recording traces showing whole
body Ca
2+
-transients in newborn animals over 1000 s. (P0) Newborn mouse (,12 hours old, P0) and (P1) a 1 to 2 day old mouse pup. The grey bar
below plots shows periods of baseline Ca
2+
activity together with the Ca
2+
-responses in black (as for Figure 5). (B (i), (ii) and (iii)), expanded time base
of the different Ca
2+
responses indicated in (A), including sustained Ca
2+
responses (i) & (iii) and Ca
2+
transients of short durations (ii). (C) Sequence of
consecutive images (video image superimposed with the bioluminescence image). A video image was taken at the beginning and at the end of
a short recording period during which a sustained and coordinated increase in Ca
2+
-induced light emission was detected across the entire body. Each
frame represents 2 s of light accumulation. Smoothing has been applied to the bioluminescent image overlay to a resolution of 1 mm. Color scale is
in photons/pixel. (D) Corresponding graph showing the time course of the Ca
2+
-responses in regions of interest shown in the first frame in Figure 6C.
(E–G) Histograms comparing data from animals less than 1 day old (P0–1; n = 9; dotted columns) and animals between 1 and 3 days old (P1–3; n =8;
light grey columns). (E) Histogram showing the mean time interval between fast Ca
2+
-transients and sustained Ca
2+
responses. (F) Histogram showing
the mean duration of sustained responses. (G) Histogram showing the total percentage of time in the absence of sustained activity. The FOV used in
these studies was 866 cm.
doi:10.1371/journal.pone.0000974.g006
Live Animal Ca2+ Imaging
PLoS ONE | www.plosone.org 8 October 2007 | Issue 10 | e974
Page 9
hidden
When transgenically expressed mtGA is reconstituted with
coelenterazine (mtGA-CLZN), it provides a high signal over
background, allowing elevations in the Ca
2+
concentration of the
mitochondrial matrix to be non-invasively investigated. Whole
animal recordings of light emission during induced Ca
2+
concentration changes in hindlimb muscle mitochondria during
contraction/relaxation cycles are well correlated with previously
reported data obtained by fluorescence microscopy in both in vivo
[8] and in vitro [8,26] studies. Up to now, in vivo imaging of calcium
signaling has remained more or less invasive, precluding its use in
freely moving, unrestrained and behaving animals. In contrast to
methods using fluorescence imaging, bioluminescence does not
require light excitation and the high contrast-to-noise ratio
afforded by mtGA-CLZN is based on the absence of background
Figure 7. Visualization of mitochondrial Ca
2+
-fluxes during kainic acid-induced seizure. Times shown above images represent time in seconds of
recording after injection of kainate. (A) Consecutive images of whole animal Ca
2+
-induced bioluminescence (each frame represents 30 s of light
accumulation) during kainic acid induced seizure (starting approx. 15 mins after drug administration). Images have a resolution of 300 mm for each
pixel. (B (i)) Video image of the cephalic area superimposed with a 2 s bioluminescence integration, 18 min after kainate injection; also shown are 2
r.o.i. whose activity is graphed versus time in (ii) and (iii). (ii) Variation of light intensity (photons/s) corresponding to the regions of interest outlined
on the video image, plotted as a function of time. The peak marked by an arrow corresponds to the bioluminescence shown in (i) and is shown with
an extended time scale in (iii) where the data at each time point represents 240 ms of light accumulation. (C (i & ii)) Same as in B, but for the dorso-
lumbar area. (D) Video image and the overlay of bioluminescence images in consecutive frames (5 s light accumulation), showing dynamic patterns
of Ca
2+
activity in the whole animal 50 minutes after injection of kainate. (B (i), C (i) & D) The FOV used in these studies was 866 cm. Smoothing has
been applied to the bioluminescent image overlay to a resolution of 1 mm. Color scale is in photons/pixel.
doi:10.1371/journal.pone.0000974.g007
Live Animal Ca2+ Imaging
PLoS ONE | www.plosone.org 9 October 2007 | Issue 10 | e974
Page 10
hidden
bioluminescence in tissues. Furthermore, the acquisition of signals
is undertaken with a photon counting system based on a cooled
GaAs intensified charge-coupled device having no readout noise.
The importance of this approach is that the imaging parameters
(e.g. spatial binning and signal integration) do not need to be
predefined. This opens up the possibility to detect Ca
2+
signals
covering a broad temporal range (from 100’s milliseconds to 100’s
seconds), which can be identified in post-processing of the data
according to signal intensities and kinetic properties.
The main advantage of imaging CRET with mtGA-CLZN lies
in its total absence of invasiveness. This new method is therefore
extremely well adapted to the analysis of calcium signaling in
behavioural states. Its trade-off is a limited spatio-temporal
resolution due to the low fluxes of collected light. In theory, the
intrinsic characteristics of the detection system used here would
allow a temporal resolution as low as 40 ms (acquisition rate at
25 Hz) and in the absence of light absorption and scattering by
tissues, a spatial resolution of 100 mm or 200 mm depending on the
field of view chosen by the operator (8 by 6 cm or 16 by 12 cm,
respectively). Schematically, the photon fluxes reaching the
detection system are a combination of (i) the photon emission rate,
which depends on the biological construction and the biological
activity, and (ii) the absorption and scattering of photons by the
living tissues, which depend on their depth of emission and their
wavelength. This latter component cannot be easily measured and
is unaccounted for in the estimation of the ‘‘true’’ spatial resolution
of the images. In practice, either the temporal or the spatial
resolution, or both, need to be decreased in order to allow sufficient
statistics of photon counting. In the different experiments reported
here, which represent a panel of different levels of light emission in
different volumes of biological tissue, either the intrinsic temporal
resolution limit (40 ms) was reached at the extent of a relatively
large degradation (i.e. smoothing) of the spatial resolution [example
in Figure 4D, 1 mm smoothing in a muscle contraction
experiment]; or alternatively, the temporal resolution was largely
degraded (i.e. integration of sequential time frames) in order to
achieve superior spatial resolution [example shown in Figure 7A,
30 s integration times for a spatial resolution of 300 mm]. In any
case, these numbers do not take into account the non-linear
relationship between the signal intensity and the degree of light
scattering and absorption in tissues, for which no formal solution
can be computed. In addition, the trade-off between spatial and
temporal resolution is a classic problem of all imaging techniques
with low count numbers, such as for instance Positron Emission
Tomography (PET). Similarly to PET, the software used here
allows list mode acquisition of events and a posteriori reconstruction
of the image set in one or several optimized sequence combina-
tions, without loss of quantitation accuracy. In particular, the
smoothing algorithms use unitary gain filters that have no effect on
output values as long as measurements are made in a region of
interest larger than the smoothing kernel (see Methods).
In its present state of development, the mtGA-CLZN/CRET
method offers spatial resolution at a tissular level in whole mice
combined with sub-second temporal resolution, and its advantage
over invasive but more resolutive techniques must be weighted on
a case-by-case basis. However, several lines of technical de-
velopment suggest that improvement of both spatial and temporal
resolutions are feasible. Firstly, it appears possible to decrease the
flux of photon absorbed in tissue by GA-like constructs with red-
shifted photoproteins [36]. Second, coupling of the GA elements
could be optimized for better resonance energy transfer. Third, the
efficiency of light collection by the detection system could be
improved by clever geometries. Future developments will tell us if
cellular resolution can be achieved with this approach.
Transgenically expressed GA-CLZN was found to be re-
markably stable and Ca
2+
signals could be monitored over hours,
which is ideal for undertaking physiological measurements in
behavioural studies. The organisation of early behaviours can be
categorised on the basis of their spontaneity and coordination. Co-
registration of whole body bioluminescence imaging of Ca
2+
signaling
with video records of behaviour, identified that fast Ca
2+
-transients
and sustained Ca
2+
-responses were well correlated with spontaneous
muscular twitches and coordinated movements, respectively. These
results indicate that whole body imaging of Ca
2+
-signaling can be
used as a molecular imaging technique to identify three major
behavioural states in newborn mice, namely atonia, muscle twitching
or startles and coordinated movements [32,37,38]. These beha-
vioural states are among the criteria used to define sleep in neonates
at ages when EEG is not a reliable marker [39,40]. In infant rats or
mice, investigators typically rely on measures of body movements or
the nuchal muscle tone in order to categorize sleep. In general,
periods of wakefulness entailing voluntary and coordinated limb
movements are followed by periods of sleep characterised by atonia
and myoclonic twitching of the limbs, before another period of
wakefulness ensues. This rhythmic activity otherwise known as the
sleep/wake cycle, undergoes rapid cycling in newborn animals
[9,38,39]. Indeed, the patterns of Ca
2+
-responses obtained from
whole body recordings had characteristics analogous to these sleep/
wake cycles. Overall, our video records of behaviour indicated that
motor patterns in newborn mice were dominated by spontaneous
muscle twitches, limb jerks and whole body startles [41]. Similarly,
the total time between sustained Ca
2+
-responses (i.e. when fast Ca
2+
transients were frequent), was calculated to be close to 80 % for
newborn animals. This is similar to the value given for the total time
spent by newborns in sleep states [9,38,42]. The duration of sustained
Ca
2+
responses recorded in our studies was also compatible with data
reported for periods of wakefulness in infant mice and rats [38,39].
Myoclonic twitching is believed to play a critical role in early
motor and somatosensory development. In particular, temporal
correlation among motor and sensory events is believed to modify
synapses through a Hebbian type learning process [43]. Indeed,
sensory input from early muscular activity has been found to precede
bursts of network activity in the developing somato-sensory cortex of
newborn rats [44]. Buzsaki and co-workers suggest that the influence
of physiological sensory input from spontaneous uncoordinated and
coordinated skeletal movement allows the three dimensional shape
and mechanical properties of the body to be established by the
sensorimotor system, which would in turn allow sensorimotor
coordination to develop. It will be interesting to investigate whether
the duration of sustained Ca
2+
responses (i.e. coordinated move-
ments) are linked to ontogenic adaptation in the mtGA mouse.
The relationship between Ca
2+
responses in the neocortex and
motion episodes was recently studied in newborn mice [9].
Synchronized Ca
2+
oscillation waves, called early network
oscillations, intrinsic to the neocortex, occur on average every
25 s during intermittent sleep-like resting periods. Early network
oscillations could not be examined in our studies due to the
difficulty of detecting brain activity in mice expressing the mtGA
probe. However, spontaneously driven Ca
2+
transients in acute
brain slices from transgenic mtGA newborn mice were readily
detectable. It will be necessary in future studies to confirm if Ca
2+
oscillations in the mitochondrial matrix parallel the intracellular
Ca
2+
concentration changes associated with early network
oscillations, which could be important at least in the context of
balancing energy demands during critical stages of development.
The major advance of this approach is that it enables optical
detection of localized Ca
2+
signals in un-restrained and non-
anaesthetised animals. Naturally, this new technique bears some
Live Animal Ca2+ Imaging
PLoS ONE | www.plosone.org 10 October 2007 | Issue 10 | e974
Page 11
hidden
limitations, such as the difficulty to detect Ca
2+
-signals in deep tissues
like the brain. The present construct does not allow Ca
2+
peaks to be
detected from the brain in vivo for two reasons. Firstly, light with
shorter wavelengths (e.g. blue & green) is strongly absorbed by tissue
[45], therefore transmission of mtGA light signals through the skin
and the skull is largely attenuated. Secondly, coelenterazine is
a substrate for p-glycoproteins that are highly expressed at the blood
brain barrier, restricting coelenterazine access to the brain [29]. At
present, transgenic mice expressing GFP-aequorin constructs are
useful for studies of peripheral organs and in particular of muscular
function. In the future, new probes under development based on red-
shifted variants of GFP-aequorin may improve the sensitivity to
undertake imaging of the brain and other deep tissues, like the liver
and the heart [36].
Changes in the position or the angle of freely moving mice or
body parts in relation to the CCD camera may also modify the
amplitude and kinetics of the light response detected. Sophisticated
algorithms for tracking regions of interest on freely moving
animals together with the implementation of different approaches,
such as stereoscopy, triangulation and spectroscopic methods are
under development in order to solve these projection artifacts.
Quantification may also be improved by co-registration of another
expressed construct, emitting Ca
2+
-independent bioluminescence
at a different spectral wavelength (i.e. one that contains a different
fluorescent acceptor, such as Renilla luciferase coupled to YFP,
which also uses the same co-factor).
The method can also be adapted to different applications. For
example, the Ca
2+
sensitivity of aequorin could be modified using
commercially available analogs of coelenterazine [46]. Alterna-
tively, a mutant version of apoaequorin could be used in place of
the native version inside the transgene, to lower its Ca
2+
binding
affinity [47]. Cell specific promoters for Cre-recombinase could
also drive expression of the transgene in selected cell types and
new lines of mice could be developed where the reporter is
targeted to other subcellular domains. Mice carrying GA
transgenes can also be crossed with disease model mice (e.g. for
neurological or muscular disorders) to follow abnormalities in Ca
2+
homeostasis, at the cellular, tissue and/or systems level.
In addition to the applications of whole animal in vivo Ca
2+
-
imaging highlighted above, other imaging reporters based on the
resonance energy transfer (e.g. BRET, CRET) mechanism can be
genetically encoded in animals and measured under similar
dynamic conditions. For instance, live imaging of protein-protein
interactions through the separate expression of 2 chimeric
proteins, one linked to an ‘acceptor’ and the other to a ‘donor’
protein, which will emit BRET when they come in close proximity
(,10 nm) [48,49]. This will require quantitative measurements at
different spectral wavelengths.
This is the first direct recording of Ca
2+
signals in vivo at the whole
mammalian level where large-scale spatio-temporal information can
be obtained about the role of intracellular Ca
2+
signaling in the
highly coordinated activity of muscle groups in the intact animal. In
addition, rapid imaging of Ca
2+
-signaling in freely moving animals is
feasible and fundamental molecular mechanisms can now be
explored non-invasively, opening new avenues for studies on the
role of Ca
2+
signaling in behavior or muscular function in more
relevant physiological contexts.
METHODS
Mice
Animal manipulation and husbandry were in agreement with the
European Commission, directives of the French Research Ministry
(885, 3180, 3181/2005 to P.B).
Generation of transgenic mice
Transgenic mice were generated using homologous recombination
in embryonic stem (ES) cells to produce transgene insertion at the
Hypoxanthine Phospho Ribosyl Transferase (hprt) locus on the X
chromosome [17]. GFP-aequorin hybrid gene (G5A) fused to the
mitochondrial matrix targeting sequence of COX VIII [18]
(Figure 1A), was cloned into the pENTRY vector (Invitrogen, CA).
The pCMV-chicken b-actin (CAG) promoter and the loxP-stop-
loxP sequence (for conditional expression of the transgene) were
cloned into the pBluescript cloning vector (Stratagene, U.S.A).
The pCAG-loxP-stop-loxP cassette was then subcloned to the 59
end of the mtGA gene in pENTRY and a poly A sequence of the rabbit
b-globulin was added 39 to the mtGA sequence. The transcription
unit was introduced by targeted insertion into ES cells by
homologous recombination at the hprt locus. During this process,
the hprt gene was functionally restored by human hprt DNA
sequences. Hprt is a ubiquitously expressed locus, ensuring minimal
variation in expression levels of the reporter in cells so that analyses
can be made both at the systems and single-cell level. Genetically
modified ES cells containing the mtGA transgene were then injected
into blastocysts (Nucleis, Speedy MouseH technology). Animals were
identified by polymerase chain reaction (PCR) using a reverse primer
localized inside of aequorin and a sense primer inside the Lox stop:
AeGFP.rev: TCAGTTATCTAGATCCGGTGG;
LoxSTOP S: CGGGAAAAAGTTAGTTGTGG.
The amplified 2.1 kb fragment covering most of the transgene was
DNA sequenced from transgenic mouse tissues.
In these studies, activation of the mtGA transgene was induced
by crossing with the PGK-Cre transgenic mouse strain, which has
ubiquitous expression of the site-specific Cre recombinase [19]. A
stable transgenic mouse line was generated that expresses the
mtGA reporter in cells from early stages of embryogenesis.
Transgenic mice were routinely genotyped by PCR of aequorin,
Cre & GFP on tail genomic DNA.
Gel electrophoresis and immunoblotting
Purified fractions of mitochondria were obtained at 4uCfromadult
transgenic mice using a similar method as previously reported [50].
Briefly, mice were euthanised by CO
2
inhalation and tissues were
quickly excised. Tissue was homogenized in the following solution
[mM: 100 KCl, 40 Tris.HCl, 10 Tris base, 5 MgCl
2
, 1 EDTA, and 1
ATP, EDTA-free protease inhibitor cocktail (Complete
TM
,Roche),
pH 7.4 at 4uC]. The preparation was then centrifuged (62), at
8006g for 10 min. Each time the supernatant was then collected and
centrifuged again at 9,0006g for 10 min to pellet the mitochondrial
population, which was resuspended in [mM: 100 KCl, 10 Tris.HCl,
10 Tris base, 1 MgSO
4
, 0.1 EDTA, and 0.02 ATP, and 1.5% BSA,
EDTA-free protease inhibitor cocktail (Complete
TM
,Roche),pH
7.4], and centrifuged at 8,0006g for 10 min. Further mitochondrial
purification was performed by Ficoll gradient as previously described
[51]. The final purified mitochondrial pellet was resuspended in
[mM: 230 mannitol, 70 sucrose, 10 Tris-HCl, 1 EDTA, EDTA-free
protease inhibitor cocktail (Complete
TM
, Roche), pH 7.4].
SDS-PAGE was performed according to the method of
Laemmli (1970), using 12% gels. Immunoblotting was undertaken
on Immobilon-P membranes (Millipore, Bedford, MA). Incuba-
tions were undertaken first with rabbit polyclonal antibodies (anti-
GFP Biovalley, anti-aequorin Abcam) in PBS containing 5 % milk
supplemented with 0.3% Tween-20, and immunoreactive proteins
were then observed by incubation with HRP-conjugated goat anti-
rabbit IgG antibodies followed by enhanced chemiluminescence
(ECL) western blotting detection reagents (Amersham, France).
Live Animal Ca2+ Imaging
PLoS ONE | www.plosone.org 11 October 2007 | Issue 10 | e974
Page 12
hidden
Histology and immunohistochemistry
The complete anterior tibialis muscle was removed, washed in PBS
1X solution then fixed for 1h in PFA 4% solution (in PBS, pH 7.4).
After washing in PBS 1X solution, the muscle was teased apart in
PBS to obtain isolated fibers. GFP fluorescence was directly
visualized in fibers after washing in PBS and mounting in FluorSave
reagent (Calbiochem, USA). For the immunofluorescence studies,
non-specific antibody binding sites were blocked by incubating fixed
muscular fibers for 30 min in PBS containing 10% normal goat
serum (NGS)/0.25% Triton X-100. After incubation, the fibers were
immunostained with a 1:500 dilution of anti-GFP polyclonal
antibody (Biovalley, France) and a 1:250 dilution of anti-cytochrome
C monoclonal antibody (BD Biosciences) in PBS containing 2%
NGS/0.25% Triton X-100/0.2% Bovine Serum Albumin (BSA)
washed with PBS containing 0.25% Triton X-100/0.2% BSA
several times, incubated with a 1:1000 dilution of a Cy
TM
3
conjugated anti-mouse antibody (Jackson ImmunoResearch) and
a 1:1000 dilution of a AlexaHFluor 488 goat anti-rabbit antibody
(Molecular Probes, Inc.). The stained preparation was then mounted
in FluorSave reagent. Confocal analysis was performed using an
Axiovert 200M laser scanning confocal microscope (LSM-510 Zeiss;
version 3.2) through a 636/1.4 NA, oil-immersion objective using
LP560 and BP505-550 filters. The pinhole aperture was set at 98 mm
and images were digitized at 8-bit resolution into a 5126512 array.
Immunoelectron microscopy
Anterior tibialis muscle was dissected out and fixed for 1 h with 4%
PFA (Electron Microscopy Sciences, Hatfield, PA, USA) in 0.1 M
phosphate buffer (PB, pH 7.4). Muscle blocks were post-fixed for
30 min with PBS containing 4% PFA, 0.1% glutaraldehyde (TAAB
Laboratories, Aldermaston, UK) and 0.2% picric acid (Sigma-
Aldrich), followed by 0.5% osmium tetroxide (Electron Microscopy
Sciences) for 30 minutes in the same buffer and embedded in LR-
White resin (Electron Microscopy Sciences). The post-embedding
inmunogold GFP labeling was followed as previously reported [52].
Thin sections were incubated with a polyclonal rabbit anti-GFP
antibody (MBL, 1:40 dilution) for 90 min followed by 60 min with
goat anti-rabbit IgG conjugated with 10 nm gold (1:25 dilution).
After gold fixation with 2.5% glutaraldehyde, samples were counter
stained and observed in a Jeol electron microscope.
Ca
2+
sensitive CRET activities on cellular extracts
and transgenic mouse tissue
Cells were prepared as previously described [14]. For green/blue
photon ratio determinations, cellular extracts and purified
mitochondrial fractions from transgenic mice (prepared as
described above), were incubated with 5 mM coelenterazine
(Interchim, Montluc¸on, France). Equal aliquots of each sample
were placed into wells of a 96-well plate. Light was recorded for
5 sec (1 sec integration) and then a 50 mM CaCl
2
solution was
injected into the well and recording was continued for a further
30 sec. Light emitted through short band-pass filters ‘blue’ (460/
30 nm) and ‘green’ (515/20 nm) was detected in independent
experiments using a luminometer (Mithras LB940, Berthold
Technologies, Germany). The ratio of light detected (RLU,
calculated as the average for the first 5 sec after injection) through
the ‘green’ to ‘blue’ filters was then determined. All experiments
were carried out at room temperature.
Preparation of the coelenterazine substrate
Coelenterazine (Interchim, France) was dissolved in ethanol to
a stock concentration of 10 mM and stored at 220uC. Care was
taken to protect the substrate from light and oxygen. The stock
solution was then diluted in sodium phosphate buffer immediately
before tail-vein (i.v.) for adults or intra-peritoneal (i.p) injection for
neonates. Coelenterazine was injected at 2–4 mg/kg mouse, in
a volume of 100–150 ml for adults and 20–40 ml for neonates.
Preparation of brain slices and in vitro detection of
Ca
2+
-activities
0–2 day old mouse pups were decapitated and brains were rapidly
removed. After removal of the cerebellum, the brain was placed on
a small platform and immersed into ice-cold oxygenated (95 % O
2
/5
%CO
2
) artificial cerebrospinal fluid (ACSF) without added CaCl
2
,
containing 124 mM NaCl, 3 mM KCl, 1.3 mM MgCl
2
,25mM
NaHCO
3
,1.25mMNaHPO
4
and 10 mM glucose. Horizontal or
coronal slices (400 mm thick) were rapidly cut using a vibratome
(Model VT-1000, Leica) and then transferred to another smaller
chamber kept at room temperature and containing ACSF (as above
but with 2 mM CaCl
2
added) and also 5–10 mM coelenterazine.
The chambers containing the slices were then maintained in the dark
for at least 1 hour before being transferred to a slice chamber
(Warner Instruments Inc. USA) for imaging and this was then placed
onto an inverted microscope, where perfusion (1 ml/min) with
oxygenated ACSF was continued throughout the remainder of the
experiment. Slices were imaged through a 10X Plan-NEOFLUAR
objective on a combined bioluminescence/fluorescence wide field
microscope system as previously described [14]. The whole field of
view, which was approximately 600 mm
2
(2566256 pixels), was
analysed for each experiment. Stock solutions of TTX (1 mM, Roth,
Karlsruhe, Germany), D-APV (50 mM, Sigma-Aldrich), CNQX
(2 mM, Sigma-Aldrich), FCCP (2 mM, Sigma-Aldrich), Piericidin A
(10 mg/ml in DMSO, Sigma-Aldrich), were stored at 220uCand
diluted in ACSF before addition to the perfusate.
Sciatic nerve stimulation experiments
8–12 week old male mice with ubiquitous expression of mtGA in
all cells of the muscles were used in experiments. Animals were
anaesthetised by isoflurane and the fur covering the area of the
hindlimb was shaved to maximize light transmission. The sciatic
nerve was then isolated and a custom made platinum bipolar
electrode was attached for stimulation of muscle contraction in the
hindlimb. The anaesthetised mouse was then transferred to the
imaging chamber and anaesthetic was continuously administered
by nose cones throughout the imaging procedure. An isolated
stimulator (DS2A, Digitimer Ltd, Welwyn Garden City, U.K.) was
used to apply a monopolar voltage pulse (polarity was chosen to
have the lowest threshold voltage), which was usually in the range
of 0.5–1.5 V/0.1-5 ms. The DS2A was driven by a pulse
generator (DG2, Digitimer Ltd) or a 4030 timer generator
(Digitimer Ltd). Variable stimulation frequencies were applied as
described in the text, with each pulse having 5 ms duration. This
protocol was based on similar work previously described [8]. In
studies determining the rate of photoprotein reconstitution in the
muscle, CLZN was injected by tail-vein and the animal was then
placed immediately inside of the imaging chamber and the
acquisition was started. Trains of stimuli (2.5 s duration) at 50 Hz
(5 ms pulses) were applied every 2 minutes and the amplitude of
the light response was followed for up to 1.5 hours. In some
studies, trains of stimuli were applied every 30 seconds. Ru360
(Calbiochem/EMD biosciences, Inc. La Jolla, CA) was dissolved
in dH
2
0 and stored as aliquots in the dark at 220uC for up to
1 week before experiments. Approximately 100 ml of Ru360 (200–
500 mM) was injected intramuscularly, in small aliquots (,20 ml)
in 5 or 6 different locations across the hindlimb muscles.
Live Animal Ca2+ Imaging
PLoS ONE | www.plosone.org 12 October 2007 | Issue 10 | e974
Page 13
hidden
Non-invasive, high resolution in vivo detection of
Ca
2+
signals
All in vivo BLI images were acquired using either one of two whole-
body small animal imaging systems based on a highly sensitive
photon counting technique: the ‘‘Photon Imager’’ or the ‘‘Video
Imager’’ (Biospace Lab, Paris, France). Both systems consist of
a light tight chamber housing a third generation cooled GaAs
intensified charge-coupled device (ICCD) camera (108061440
pixels) operating in a photon counting mode and an F 1.4
objective lens. The field of view (FOV) is either 16612 cm or
866 cm depending on the platform position, yielding an ‘‘in-
trinsic’’ resolution of the camera of 100 mm (smallest FOV) or
200 mm (largest FOV). This true spatial resolution in the final
image depends on light absorption and scattering in tissues and
also on image smoothing, which is user-dependant. Post
acquisition, spatial smoothing of the BLI data is available (i)
during reconstruction of the BLI image, by a Gaussian filter with
a FWHM (full width at half maximum) size of 3, 5, or 9 times the
pixel size; or (ii) during reconstruction of the composite (BLI plus
video) image, by a Gaussian filter with a FWHM expressed in mm.
Information regarding the processing of images is given in the
legend of each figure. Color scales represent photons/pixel, unless
otherwise stated.
With the ‘‘Photon Imager’’, video images can be taken before or
after recording the bioluminescence images, for superimposition.
The ‘‘Video Imager’’ is very similar to the ‘‘Photon Imager’’, for
the exception that it enables simultaneous registration of bio-
luminescence images and video images using infrared LEDs. The
light collected by the objective lens is split by a 45u angle mirror
into two beams. One of these beams is then recorded as the video
signal on a CCD camera and the other beam is acquired as the
BLI signal (as described above) after filtering with a short-pass
filter. Both systems operate at up to 25 frames/s (40 ms exposure
time) but longer integration times can be selected after acquisition
for data analysis and replay.
EMG experiments
An average of 10 electromyograms (EMG) were recorded by a ball
shaped silver electrode (,1,5 mm in diameter) covered with AgCl
and positioned under the leg skin in the vicinity of the tibialis
muscle while stimulating the sciatic nerve. The induced contrac-
tions were of the isotonic type, the leg being free to move. EMG
signals were recorded through a NPI (Tamm, Germany) amplifier
system (Ext-10C extracellular amplifier module + LPBF-01G
Bessel filter–set at 200 Hz, both housed in a EPMS-07 enclosure)
onto a ‘‘D.A.T.’’ recorder (Biologic, Claix, France) for further
measurement and analysis. Measurements were performed using
an Axon Instruments (now part of ‘‘Molecular Devices’’, U.S.A.)
TL1 acquisition system operated with Pclamp-6 software (now
part of ‘‘Molecular Devices’’, U.S.A.); analysis was made with the
Origin-7 graph package (Northampton MA, USA). The same
stimulation system as described above was used. The light intensity
during muscle contractions was recorded as a function of time
using 40 ms frames. Light and EMG records were synchronised by
generating a dim pulse of light from a small LED located near by
the animal under study in the imager, in synchrony with the
trigger applied to the isolated stimulator.
In vivo detection of Ca
2+
activity in freely moving
mice
1–2 day old mice expressing mtGA were injected (i.p.) with native
coelenterazine (2–4 mg/g of body weight; Interchim France). After
1–2 hours, non-anaesthetised mice were imaged at room temper-
ature (25uC) un-restrained and freely moving. Ca
2+
-induced
bioluminescence was co-registered with the video recording using
an acquisition rate of 25 Hz (Video Imager, Biospace Lab, Paris,
France). Motor twitches and coordinated movements were also
visually recorded by placing a scoring of 1 for each frame (1
frame/s) when movements were present and 0 when they were
not. The resulting plot was then generated using Microsoft Excel
Software. For comparison to Ca
2+
-responses, coordinated move-
ments are defined as sustained motor activity of the limbs or head.
Motor twitches are defined as phasic, rapid, and independent
movements of one limb or the tail. Startles are sudden phasic
contractions of the body muscles, with the simultaneous in-
volvement of all extremities [31,32,38].
In additional experiments, freely moving animals were also
monitored with the Photon Imager. 0–3 day old mice expressing
mtGA were injected (as above) with coelenterazine and imaged 1–
2 hours later at room temperature (25uC). Mouse pups were
placed inside a circular cardboard barrier that was 4 cm in
diameter for 30 min prior to the beginning of recordings.
Recordings of mice were then undertaken for up to 1 hour. For
experimental analysis, a single region of interest was drawn over
the entire area within the barrier and plots with 120 ms of time
integration over 1500 s were analysed. The interval between fast
Ca
2+
-responses (,1 s duration) and sustained Ca
2+
-responses
(.1 s) was determined. A threshold was set for Ca
2+
-responses
at 30 photons/s above the mean of the baseline in subsections of
the trace. The interval between sustained Ca
2+
-responses was
determined by taking the time point at the start of one sustained
response to the time point at the start of the next sustained
response. The interval between fast Ca
2+
-transients was de-
termined between each sleep/wake cycle (i.e. between sustained
responses). The duration of sustained Ca
2+
-responses was de-
termined as the time point at the start of the rising phase until the
last visible peak or shoulder above the threshold, in order to avoid
including the decay phase.
Detection of mitochondrial Ca
2+
signals during
epileptic seizure
Mice (P6–P18) were injected (i.p.) with coelenterazine (4 mg/g).
After 2 hours, kainic acid (25 mg/kg) was injected (i.p.) and the
distribution of mitochondrial Ca
2+
fluxes were monitored in the
whole animal during seizure. Kainic acid (Sigma-Aldrich) was
prepared by dissolving the lyophilized drug first in a drop of
NaOH and then making a further dilution in PBS to the required
concentration.
Statistical analysis
Data was analyzed using MicrosoftHExcel 2002. Results are given
as the mean6s.e.m.
Abbreviations: [Ca
2+
], calcium concentration; [Ca
2+
]
m
,[Ca
2+
]in
the mitochondrial matrix; BLI, bioluminescence imaging; ENO,
early network oscillations; GFP, green fluorescent protein; GA, GFP-
aequorin; CLZN, coelenterazine; CRET, chemiluminescence reso-
nance energy transfer; hprt, Hypoxanthine Phosphorylated Ribosyl
Transferase; mtGA, mitochondrially targeted GFP-aequorin; TTX,
tetrodotoxin; D-APV, D-2-amino-5-phosphonovaleric acid; CNQX,
6-cyano-7-nitro-quinoxaline-2-3-dione; FCCP, carbonyl cyanide 4-
(trifluoromethoxy) phenylhydrazone; SR, sarcoplasmic reticulum;
YC2, second generation yellow cameleon; FOV, field of view;
BRET, bioluminescence resonance energy transfer; ES, embryonic
stem cells; CAG, pCMV-chicken b-actin; RLU, Relative light units;
FWHM, Full-Width Half-Maximum.
Live Animal Ca2+ Imaging
PLoS ONE | www.plosone.org 13 October 2007 | Issue 10 | e974
Page 14
hidden
SUPPORTING INFORMATION
Movie S1 In vivo imaging of Ca2+-induced bioluminescence in
the intact mouse during hindlimb muscle contraction/relaxation
induced by tetanic stimulation of the sciatic nerve (5 ms pulses at
50 Hz for a duration of 2.5 s). The sequence of bioluminescence
images were superimposed over the video, which was acquired
using the same protocol but in an independent experiment. The
integration time for each bioluminescence image is 1 s (6 frames/
s). The bioluminescence overlay has a resolution of 0.3 mm for
each pixel. The light emission (photons/pixel/s) is coded in
pseudocolors (0.07–0.7).
Found at: doi:10.1371/journal.pone.0000974.s001 (0.74 MB
MOV)
Movie S2 An example of a whole body startle. Changes in
mitochondrial [Ca2+] (bioluminescence) were co-registered to-
gether with the video image in a newborn mouse (P1). The movie
was recorded with the ‘‘Video Imager’’. The animation represents
consecutive frames recorded over approximately 1.5 s (see the
corresponding light emission profile in Figure 5A). The integration
time for each frame (bioluminescence & video) is 40 ms. There are
44 frames in total and the film runs approximately 3 times slower
than the actual event (60.34). Smoothing has been applied to the
bioluminescent image overlay to a resolution of 5 mm. The light
emission (photons/pixel) is coded in pseudocolors as outlined for
Figure 5B (i).
Found at: doi:10.1371/journal.pone.0000974.s002 (0.89 MB
MOV)
Movie S3 An example of coordinated movement. As for Movie
S2, changes in mitochondrial [Ca2+] and the video imager were
recorded simultaneously. The animation represents consecutive
frames recorded over approximately 5 s (see the corresponding
light emission profile in Figure 5A). The integration time for each
video frame is 40 ms. The bioluminescence overlay of each frame
is 160 ms of integrated light. The video is made up of a series of
sliding frames, each shifted by 40 ms. The actual event is seen in
real time (1 X). Smoothing has been applied to the bioluminescent
image overlay to a resolution of 3.5 mm. The light emission
(photons/pixel) is coded in pseudocolors as outlined for Figure 5B
(ii).
Found at: doi:10.1371/journal.pone.0000974.s003 (2.45 MB
MOV)
Movie S4 Visualization of mitochondrial Ca2+-fluxes during
kainic acid-induced seizure. A 7 day old mouse pup was injected
(i.p.) with coelenterazine. After 2 hours, kainic acid (25 mg/kg)
was injected (i.p.) and the distribution of mitochondrial Ca2+
fluxes were monitored in the whole animal during seizure. The
sequence shows whole animal Ca2+-induced bioluminescence
during kainic acid induced seizure. Frames have a resolution of
300 mm for each pixel. Color scale is 0.02–1.0 photons/pixel. The
integration time for each image is 30 s (6 frames/s).
Found at: doi:10.1371/journal.pone.0000974.s004 (0.75 MB
MOV)
Movie S5 Whole body patterns of Ca2+- induced biolumines-
cence approximately 50 mins after kainate-induced seizure in
a 7 day old mouse pup. A video image was recorded at the
beginning of the acquisition and is merged with the biolumines-
cence recording, which consists of 2 s frames. Smoothing has been
applied to the bioluminescent image overlay to a resolution of
1 mm and the color scale is 0.01–0.1 photons/pixel. There are 50
frames in total (6 frames/s).
Found at: doi:10.1371/journal.pone.0000974.s005 (1.18 MB
MOV)
ACKNOWLEDGMENTS
Thanks to Y. Lallemand (Institut Pasteur, Paris) for providing the PGK-
Cre transgenic mouse strain and also L. Tiret (Maison Alfort Veterinarian
School, Paris) and R. Wilmotte (Nucleis, Lyon, France) for helpful
discussions. S. Maitrejean and O. Levrey (Biospace Lab, Paris) for
assistance and further developments of the Photon Imager. Thanks to K.
Siquier, B. Jego and H. Boutin for assistance and to the Plateforme
d’Imagerie Dynamique, Institut Pasteur, for assistance with microscopy.
C.C. was on sebatical from the Facultad de Medicina, Universidad de Los
Andes, Me´rida, Venezuela.
Author Contributions
Conceived and designed the experiments: BT PB KR. Performed the
experiments: RB KR SP ER CC JS. Analyzed the data: BT RB PB KR SP
ER CC JS. Contributed reagents/materials/analysis tools: BT PB JS.
Wrote the paper: BT PB KR.
REFERENCES
1. Berridge MJ, Bootman MD, Roderick HL (2003) Calcium signalling: dynamics,
homeostasis and remodelling. Nat Rev Mol Cell Biol 4: 517–529.
2. Rizzuto R, Pozzan T (2006) Microdomains of intracellular Ca2+: molecular
determinants and functional consequences. Physiol Rev 86: 369–408.
3. LaFerla FM (2002) Calcium dyshomeostasis and intracellular signalling in
Alzheimer’s disease. Nat Rev Neurosci 3: 862–872.
4. Ophoff RA, Terwindt GM, Vergouwe MN, van Eijk R, Oefner PJ, et al. (1996)
Familial hemiplegic migraine and episodic ataxia type-2 are caused by mutations
in the Ca2+ channel gene CACNL1A4. Cell 87: 543–552.
5. Augustine GJ, Santamaria F, Tanaka K (2003) Local calcium signaling in
neurons. Neuron 40: 331–346.
6. Nagai T, Yamada S, Tominaga T, Ichikawa M, Miyawaki A (2004) Expanded
dynamic range of fluorescent indicators for Ca(2+) by circularly permuted yellow
fluorescent proteins. Proc Natl Acad Sci U S A 101: 10554–10559.
7. Hasan MT, Friedrich RW, Euler T, Larkum ME, Giese G, et al. (2004)
Functional fluorescent Ca2+ indicator proteins in transgenic mice under TET
control. PLoS Biol 2: e163.
8. Rudolf R, Mongillo M, Magalhaes PJ, Pozzan T (2004) In vivo monitoring of
Ca(2+) uptake into mitochondria of mouse skeletal muscle during contraction.
J Cell Biol 166: 527–536.
9. Adelsberger H, Garaschuk O, Konnerth A (2005) Cortical calcium waves in
resting newborn mice. Nat Neurosci 8: 988–990.
10. So MK, Xu C, Loening AM, Gambhir SS, Rao J (2006) Self-illuminating
quantum dot conjugates for in vivo imaging. Nat Biotechnol 24: 339–343.
11. Hardy J, Francis KP, DeBoer M, Chu P, Gibbs K, et al. (2004) Extracellular
replication of Listeria monocytogenes in the murine gall bladder. Science 303:
851–853.
12. Abraham U, Prior JL, Granados-Fuentes D, Piwnica-Worms DR, Herzog ED
(2005) Independent circadian oscillations of Period1 in specific brain areas in
vivo and in vitro. J Neurosci 25: 8620–8626.
13. Baubet V, Le Mouellic H, Campbell AK, Lucas-Meunier E, Fossier P, et al.
(2000) Chimeric green fluorescent protein-aequorin as bioluminescent Ca2+
reporters at the single-cell level. Proc Natl Acad Sci U S A 97: 7260–7265.
14. Rogers KL, Stinnakre J, Agulhon C, Jublot D, Shorte SL, et al. (2005)
Visualization of local Ca2+ dynamics with genetically encoded bioluminescent
reporters. Eur J Neurosci 21: 597–610.
15. Loew LM, Carrington W, Tuft RA, Fay FS (1994) Physiological cytosolic Ca2+
transients evoke concurrent mitochondrial depolarizations. Proc Natl Acad
Sci U S A 91: 12579–12583.
16. Jouaville LS, Pinton P, Bastianutto C, Rutter GA, Rizzuto R (1999) Regulation
of mitochondrial ATP synthesis by calcium: evidence for a long-term metabolic
priming. Proc Natl Acad Sci U S A 96: 13807–13812.
17. Bronson SK, Plaehn EG, Kluckman KD, Hagaman JR, Maeda N, et al. (1996)
Single-copy transgenic mice with chosen-site integration. Proc Natl Acad
Sci U S A 93: 9067–9072.
18. Rizzuto R, Simpson AW, Brini M, Pozzan T (1992) Rapid changes of
mitochondrial Ca2+ revealed by specifically targeted recombinant aequorin.
Nature 358: 325–327.
Live Animal Ca2+ Imaging
PLoS ONE | www.plosone.org 14 October 2007 | Issue 10 | e974
Page 15
hidden
19. Lallemand Y, Luria V, Haffner-Krausz R, Lonai P (1998) Maternally expressed
PGK-Cre transgene as a tool for early and uniform activation of the Cre site-
specific recombinase. Transgenic Res 7: 105–112.
20. Gorokhovatsky AY, Marchenkov VV, Rudenko NV, Ivashina TV,
Ksenzenko VN, et al. (2004) Fusion of Aequorea victoria GFP and aequorin
provides their Ca(2+)-induced interaction that results in red shift of GFP
absorption and efficient bioluminescence energy transfer. Biochem Biophys Res
Commun 320: 703–711.
21. Garaschuk O, Linn J, Eilers J, Konnerth A (2000) Large-scale oscillatory calcium
waves in the immature cortex. Nat Neurosci 3: 452–459.
22. Bell CJ, Bright NA, Rutter GA, Griffiths EJ (2006) ATP regulation in adult rat
cardiomyocytes: time-resolved decoding of rapid mitochondrial calcium spiking
imaged with targeted photoproteins. J Biol Chem 281: 28058–28067.
23. Kovacs R, Kardos J, Heinemann U, Kann O (2005) Mitochondrial calcium ion
and membrane potential transients follow the pattern of epileptiform discharges
in hippocampal slice cultures. J Neurosci 25: 4260–4269.
24. Robert V, Gurlini P, Tosello V, Nagai T, Miyawaki A, et al. (2001) Beat-to-beat
oscillations of mitochondrial [Ca2+] in cardiac cells. Embo J 20: 4998–5007.
25. Robb-Gaspers LD, Burnett P, Rutter GA, Denton RM, Rizzuto R, et al. (1998)
Integrating cytosolic calcium signals into mitochondrial metabolic responses.
Embo J 17: 4987–5000.
26. Lannergren J, Westerblad H, Bruton JD (2001) Changes in mitochondrial Ca2+
detected with Rhod-2 in single frog and mouse skeletal muscle fibres during and
after repeated tetanic contractions. J Muscle Res Cell Motil 22: 265–275.
27. Bhaumik S, Gambhir SS (2002) Optical imaging of Renilla luciferase reporter
gene expression in living mice. Proc Natl Acad Sci U S A 99: 377–382.
28. Zhao H, Doyle TC, Wong RJ, Cao Y, Stevenson DK, et al. (2004)
Characterization of coelenterazine analogs for measurements of Renilla
luciferase activity in live cells and living animals. Mol Imaging 3: 43–54.
29. Pichler A, Prior JL, Piwnica-Worms D (2004) Imaging reversal of multidrug
resistance in living mice with bioluminescence: MDR1 P-glycoprotein transports
coelenterazine. Proc Natl Acad Sci U S A 101: 1702–1707.
30. Bruton J, Tavi P, Avdin J, Westerblad H, Lannergren J (2003) Mitochondrial
and myoplasmic [Ca2+] in single fibres from mouse limb muscles during
repeated tetanic contractions. J Physiol 551: 179–190.
31. Blumberg MS, Lucas DE (1996) A developmental and component analysis of
active sleep. Dev Psychobiol 29: 1–22.
32. Gramsbergen A, Schwartze P, Prechtl HF (1970) The postnatal development of
behavioral states in the rat. Dev Psychobiol 3: 267–280.
33. De Sarro G, Ibbadu GF, Marra R, Rotiroti D, Loiacono A, et al. (2004) Seizure
susceptibility to various convulsant stimuli in dystrophin-deficient mdx mice.
Neurosci Res 50: 37–44.
34. Hayashi M, Morimoto R, Yamamoto A, Moriyama Y (2003) Expression and
localization of vesicular glutamate transporters in pancreatic islets, upper
gastrointestinal tract, and testis. J Histochem Cytochem 51: 1375–1390.
35. Brand-Schieber E, Werner P (2003) AMPA/kainate receptors in mouse spinal
cord cell-specific display of receptor subunits by oligodendrocytes and astrocytes
and at the nodes of Ranvier. Glia 42: 12–24.
36. Curie T, Rogers KL, Colasante C, Brulet P (2007) Red-shifted aequorin based
bioluminescent reporters for in vivo imaging of Ca
2+
-signaling. Molecular
Imaging 6(1): 30–42.
37. Karlsson KA, Kreider JC, Blumberg MS (2004) Hypothalamic contribution to
sleep-wake cycle development. Neuroscience 123: 575–582.
38. Durand E, Dauger S, Pattyn A, Gaultier C, Goridis C, et al. (2005) Sleep-
disordered breathing in newborn mice heterozygous for the transcription factor
Phox2b. Am J Respir Crit Care Med 172: 238–243.
39. Blumberg MS, Karlsson KA, Seelke AM, Mohns EJ (2005) The ontogeny of
mammalian sleep: a response to Frank and Heller (2003). J Sleep Res 14: 91–98.
40. Frank MG, Heller HC (1997) Development of REM and slow wave sleep in the
rat. Am J Physiol 272: R1792–1799.
41. Karlsson KA, Blumberg MS (2002) The union of the state: myoclonic twitching
is coupled with nuchal muscle atonia in infant rats. Behav Neurosci 116:
912–917.
42. Blumberg MS, Seelke AM, Lowen SB, Karlsson KA (2005) Dynamics of sleep-
wake cyclicity in developing rats. Proc Natl Acad Sci U S A 102: 14860–14864.
43. Karlsson KA, Gall AJ, Mohns EJ, Seelke AM, Blumberg MS (2005) The neural
substrates of infant sleep in rats. PLoS Biol 3: e143.
44. Khazipov R, Sirota A, Leinekugel X, Holmes GL, Ben-Ari Y, et al. (2004) Early
motor activity drives spindle bursts in the developing somatosensory cortex.
Nature 432: 758–761.
45. Zhao H, Doyle TC, Coquoz O, Kalish F, Rice BW, et al. (2005) Emission
spectra of bioluminescent reporters and interaction with mammalian tissue
determine the sensitivity of detection in vivo. J Biomed Opt 10: 41210.
46. Shimomura O, Musicki B, Kishi Y (1989) Semi-synthetic aequorins with
improved sensitivity to Ca2+ ions. Biochem J 261: 913–920.
47. Kendall JM, Sala-Newby G, Ghalaut V, Dormer RL, Campbell AK (1992)
Engineering the CA(2+)-activated photoprotein aequorin with reduced affinity
for calcium. Biochem Biophys Res Commun 187: 1091–1097.
48. Pfleger KD, Eidne KA (2006) Illuminating insights into protein-protein
interactions using bioluminescence resonance energy transfer (BRET). Nat
Methods 3: 165–174.
49. De A, Gambhir SS (2005) Noninvasive imaging of protein-protein interactions
from live cells and living subjects using bioluminescence resonance energy
transfer. Faseb J 19: 2017–2019.
50. Bizeau ME, Willis WT, Hazel JR (1998) Differential responses to endurance
training in subsarcolemmal and intermyofibrillar mitochondria. J Appl Physiol
85: 1279–1284.
51. Clark JB, Nicklas WJ (1970) The metabolism of rat brain mitochondria.
Preparation and characterization. J Biol Chem 245: 4724–4731.
52. Roux S, Colasante C, Saint Cloment C, Barbier J, Curie T, et al. (2005)
Internalization of a GFP-tetanus toxin C-terminal fragment fusion protein at
mature mouse neuromuscular junctions. Mol Cell Neurosci 30: 572–582.
Live Animal Ca2+ Imaging
PLoS ONE | www.plosone.org 15 October 2007 | Issue 10 | e974

Sign up today - FREE

Mendeley saves you time finding and organizing research. Learn more

  • All your research in one place
  • Add and import papers easily
  • Access it anywhere, anytime

Start using Mendeley in seconds!

Already have an account? Sign in

Readership Statistics

18 Readers on Mendeley
by Discipline
 
 
 
by Academic Status
 
28% Post Doc
 
28% Ph.D. Student
 
11% Other Professional
by Country
 
39% United States
 
17% United Kingdom
 
17% France