381
Quantitative real-time PCR (QPCR) is an extremely powerful
and sensitive method for quantitative detection of microor-
ganisms. In contrast to end-point analysis by conventional
PCR, real-time detection by QPCR measures the change in
product concentration as an increase in fluorescence (∆Rn)
during each PCR cycle (Heid et al. 1996). The fractional cycle
number (Ct) is calculated for each reaction at a point where the
fluorescence signal crosses a certain threshold. Several studies
have demonstrated the potential of the methodology for the
quantitative analysis of microorganisms (Cullen et al. 2002;
Fontaine and Guillot 2002; Phister and Mills 2003; Skovhus
2004; Suzuki et al. 2000; Vaitomaa et al. 2003) including harm-
ful algal bloom (HAB) species (Bowers et al. 2000; Galluzzi et al.
2004; Gray et al. 2003; Popels et al. 2003; Saito et al. 2002) in
environmental samples. The basic approach used in these stud-
ies is to generate a standard curve using plasmids with the tar-
get DNA sequence or DNA extracted from cultures with known
concentrations of the target species. While this process is rela-
tively straightforward, the application of QPCR to environ-
mental studies sometimes produces variable results (Cullen et
al. 2002; Kolb et al. 2003; Vaitomaa et al. 2003). There are two
main reasons for this. First, the amplification efficiencies of
plasmids or laboratory cultures used for generation of a stan-
dard curve may not accurately represent the amplification effi-
ciencies of DNA extracted from environmental samples (see
e.g., Becker et al. 2000). Second, QPCR methods often fail to
incorporate controls to assess the accuracy of the results. DNA
extracted from environmental samples, in particular, can vary
Improved quantitative real-time PCR assays for enumeration of
harmful algal species in field samples using an exogenous DNA
reference standard
Kathryn J. Coyne
1*
, Sara M. Handy
1
, Elif Demir
1
, Edward B. Whereat
1
, David A. Hutchins
1
, Kevin J. Portune
1
,
Martina A. Doblin
2
, and S. Craig Cary
1
1
University of Delaware, College of Marine Studies, 700 Pilottown Rd., Lewes, DE 19958 USA
2
Institute of Water and Environmental Resource Management, Department of Environmental Sciences, University of
Technology, Sydney, Westbourne St, Gore Hill, NSW 2065, Australia
Abstract
Quantitative real-time PCR (QPCR) is a powerful and sensitive method for quantitative detection of microor-
ganisms. Application of this methodology for enumeration of harmful algal bloom (HAB) species has the poten-
tial to revolutionize our approach to HAB research, making it possible to identify correlations between cell abun-
dances and factors that regulate bloom dynamics. Its application to ecological studies, however, has produced
mixed results. QPCR assays typically rely on the generation of standard curves from plasmids or laboratory cul-
tures that may be unrealistic when compared to amplification of DNA extracted from field samples. In addition,
existing methods often fail to incorporate controls to assess variability in extraction and amplification efficiencies,
or include controls that are sequence-specific and preclude the investigation of multiple species. Here, we describe
the development and rigorous analysis of QPCR assays for two HAB species, Chattonella subsalsa and Heterosigma
akashiwo, in which we introduce a known concentration of exogenous DNA plasmid into the extraction buffer as
a reference standard. Since the target DNA is extracted in the presence of the reference standard, inherent vari-
ability in extraction and amplification efficiencies affect both target and standard equally. Furthermore, the refer-
ence standard is applicable to QPCR analysis of any microbial species. Using environmental bloom samples as cal-
ibrators, we evaluated the accuracy of the comparative Ct method for enumeration of target species in several field
samples. Our investigation demonstrates that the comparative Ct method with an exogenous DNA reference stan-
dard provides both accurate and reproducible quantification of HAB species in environmental samples.
*E-mail: kcoyne@udel.edu
Acknowledgments
We thank Yaohong Zhang (University of Delaware) for technical assis-
tance. Lauren Salvitti (Goucher College) and Brian Keuski (University of
Delaware) also assisted with sample processing and primer development.
We are grateful to the Inland Bays Citizen Monitoring Program (coordi-
nated by EBW) for assistance with sample collection and cell counts. This
research was funded by grants from USA-EPA STAR-ECOHAB (to DAH,
KJC, SCC, and MAD), NOAA MERHAB (to SCC and KJC), and from the
Center for the Inland Bays (to EBW).
Limnol. Oceanogr.: Methods 3, 2005, 381–391
© 2005, by the American Society of Limnology and Oceanography, Inc.
LIMNOLOGY
and
OCEANOGRAPHY: METHODS

significantly in quantity and quality, affecting the outcome of
quantitative PCR by several-fold (Bostrom et al. 2004). Copre-
cipitation of compounds that inhibit PCR also confounds
molecular analyses of environmental samples (Stults et al.
2001; Tebbe and Vahjen 1993; Wilson 1997) by producing false
negative results.
The relative QPCR approach, in which the target gene is nor-
malized to a reference standard, provides a more accurate assess-
ment of cell abundances. Methods have been described, for
example, in which cells are spiked into samples (Brinkman et al.
2003; Lebuhn et al. 2004), reducing error due to inherent dif-
ferences in extraction or amplification efficiencies. These
methods rely on the assumption that the lysing efficiency of
spiked cells is the same as target cells for every sample. In addi-
tion, samples are spiked independently, potentially introduc-
ing another source of error. Other methods incorporate refer-
ence standards that are sequence-specific and preclude the
QPCR quantification of multiple and diverse targets from the
same field sample. Widada et al. (2002), for example, spiked
cells containing an artificial construct competitor DNA
directly into the extraction buffer for use in competitive
QPCR. Analysis of multiple species, however, requires that a
separate construct be prepared and calibrated for each species
under investigation.
Here, we describe the development of relative QPCR assays
for quantification of two Raphidophyte species, Chattonella
subsalsa and Heterosigma akashiwo. These organisms have gained
recognition as fish-killing phytoplankton, causing massive
mortalities of fish and resulting in millions of dollars in dam-
age to the aquaculture industry (Black et al. 1991; Horner 1999;
Yang et al. 1995). In addition, brevetoxin-like compounds pro-
duced by Raphidophytes (Haque and Onoue 2002; Khan et al.
1996a, 1996b, 1997) pose a threat to higher trophic levels
(including wildlife and humans) since they can potentially be
concentrated during food web transfer (Ishida et al. 2004;
Plakas et al. 2004; Stommel and Watters 2004; Woofter et al.
2005). Conventional microscopic methods for identifying
and estimating the abundance of Raphidophyte species in
complex environmental samples are time-consuming and
often lack the sensitivity required for background level
detection. Some species, such as Heterosigma akashiwo, can
also be pleomorphic, making them difficult to identify in
complex mixtures. Further, Raphidophytes are very fragile,
and cell counts of environmental samples prepared with
standard phytoplankton fixation methods may be unreliable
(Throndsen 1997).
Our objectives were to develop QPCR methods for rapid,
sensitive, and accurate identification and enumeration of
Raphidophytes in environmental water samples. To eliminate
errors due to extraction and amplification efficiencies, a known
concentration of exogenous plasmid DNA was introduced into
the extraction buffer as a reference standard. We determined
the sensitivity of the assay and range of detection for each of
the target genes. Intra-sample variability (precision) was eval-
uated for environmental samples with both high and low
abundances of the target species. Finally, we evaluated the
accuracy of the comparative Ct method (Livak and Schmittgen
2001) using an environmentally relevant calibrator sample for
QPCR quantification of Chattonella subsalsa and Heterosigma
akashiwo in several field samples. The calibrator consisted of
DNA extracted from field samples during blooms of H.
akashiwo and C. subsalsa. Accurate cell counts of each target
species in the calibrator samples provided a comparative basis
for calculating cell abundances in unknown field samples. The
approach described here may be applied to development of
QPCR assays of other microbial species in complex environ-
mental samples.
Materials and procedures
Determination of 18S rDNA sequences—Delaware Inland Bays
(DIB) isolates Chattonella subsalsa (CCMP 2191) and Heterosigma
akashiwo (CCMP 2393) were cultured at 24°C in f/2 growth
medium (Guillard 1975). Cells were collected by centrifuga-
tion and lysed in 0.7 mL CTAB buffer (100 mM Tris-HCl [pH 8],
1.4 M NaCl, 20 mM EDTA, 2% [w/v] cetyltrimethylammo-
nium bromide [CTAB], 0.4% [v/v] β-mercaptoethanol, 1%
[w/v] polyvinylpyrollidone; [Dempster et al. 1999]). DNA was
extracted as in Coyne et al. (2001). The region spanning the
18S through ITS2 region of the rDNA gene was amplified by
PCR in a 20-µL reaction volume containing 0.2 mM dNTPs,
0.5 µM Euk A (5′ AACCTGGTTGATCCTGCCAGT 3′) (Medlin et
al. 1988), 0.5 µM Raph ITS R (5′ YGCCAGGTGCGTTCGAA 3′),
2.5 mM MgCl
2
, 1X Taq polymerase buffer (Sigma Chem. Co.),
and 0.5 units Jump-Start Taq Polymerase (Sigma Chem. Co.).
The reaction consisted of 35 cycles of 30 s at 94°C, 30 s at
56°C, and 2.5 min at 72°C, followed by a 5-min extension at
72°C. PCR products were cloned into pCR4 TOPO plasmid
vector (Invitrogen) and bi-directionally sequenced using Big
Dye Terminator Cycle Sequencing Ready Reaction Kit (Applied
Biosystem).
Quantitative real-time PCR primers and probes—Primer and
probe sites for Chattonella subsalsa and Heterosigma akashiwo
were identified by aligning the 18S rDNA sequences of the DIB
isolates to sequences of closely related species in GenBank
(www.ncbi.nlm.nih.gov) using Clustal (Thompson et al. 1994)
in the Genetic Data Environment (Smith et al. 1994). Each
primer pair was designed to amplify approximately 350 bp of
the 18S rDNA gene (Table 1).
Taqman probes were designed using Primer Express soft-
ware (Applied Biosystems). The probes were synthesized with
a 6-FAM (6-carboxyfluorescein) reporter dye at the 5′ end and
a TAMRA (6-carboxytetramethylrhodamine) quencher mole-
cule at the 3′ end. Primer and probe concentrations were opti-
mized for quantitative real-time PCR on an ABI Prism 7700
Sequence Detection System (Applied Biosystems) using cloned
plasmids containing the 18S rDNA sequence for Chattonella
subsalsa and Heterosigma akashiwo as template. Optimized
reaction conditions for each target species consisted of a 25-µL
Coyne et al. Improved QPCR quantification of algal species
382