Selection of bacteriophage j integrases with
altered recombination specificity by in vitro
compartmentalization
Yvonne Tay
1
, Candice Ho
1
, Peter Dro
00
ge
2
and Farid J. Ghadessy
1,
*
1
p53 Laboratory, 8A Biomedical Grove, #06-06, Immunos, Singapore 138648 and
2
Division of Genomics
and Genetics, School of Biological Sciences, Nanyang Technological University, 60 Nanyang Drive,
Singapore 637551
Received September 4, 2009; Revised November 6, 2009; Accepted November 7, 2009
ABSTRACT
In vitro compartmentalization (IVC) was employed for
the first time to select for novel bacteriophage j
integrase variants displaying significantly enhanced
recombination activity on a non-cognate target DNA
sequence. These variants displayed up to 9-fold
increased recombination activity over the parental
enzyme, and one mutant recombined the chosen
non-cognate substrate more efficiently than the
parental enzyme recombined the wild-type DNA
substrate. The in vitro specificity phenotype
extended to the intracellular recombination of
episomal vectors in HEK293 cells. Surprisingly,
mutations conferring the strongest phenotype do
not occur in the j integrase core-binding domain,
which is known to interact directly with cognate
target sequences. Instead, they locate to the
N-terminal domain which allosterically modulates
integrase activity, highlighting a previously
unknown role for this domain in directing integrase
specificity. The method we describe provides a
robust, completely in vitro platform for the develop-
ment of novel integrase reagent tools for in vitro
DNA manipulation and other biotechnological
applications.
INTRODUCTION
Conservative site-specific DNA recombinases directing
the manipulation of transgenes are essential tools for con-
trolled genome modifications. Notably, the Cre and Flp
recombinases have been developed into powerful tools
facilitating excision, integration, inversion and trans-
locations of DNA segments between their respective recom-
bination target sites (also referred to as cognate sites) (1–4).
However, the absence of endogenous cognate sites in mam-
malian genomes usually requires these to be stably
introduced through either homologous recombination,
e.g. in mouse embryonic stem cells, or by random integra-
tion (5). The ‘primed’, predetermined locus is then
amenable to targeted manipulation by site-specific recom-
bination reactions.
A potential strategy to overcome this limitation is to
engineer recombinases with altered site specificities (6–8).
To this end, Cre recombinase variants have been described
that are able to specifically recombine novel target sites
and excise HIV proviral genomic DNA in mammalian
cells (9,10). Flp and bacteriophage phiC31 recombinase
variants have also been described that utilize native
genomic sequences as recombination target sites (11,12).
Other approaches include chimeric enzymes comprising of
a recombinase domain fused to zinc finger modules with
defined DNA-binding specificities (13,14). Site-specific
zinc finger nucleases that stimulate homologous recombi-
nation at the site of an induced genomic DNA double-
strand break represent another strategy for achieving
directed gene replacement inside eukaryotic cells (15,16).
Bacterial selection systems relying on identification
of functional mutants through reporter gene activation
(17–20) or substrate-linked protein evolution (10) are the
predominant methodologies for engineering altered site-
specificities in recombinases. A genetic selection system
in yeast has also been described that yielded HIV-1
integrase variants displaying altered DNA-binding
affinities (21). In vitro compartmentalization (IVC) is a
cell-free directed evolution platform, wherein gene
variants and the proteins they encode are clonally
encapsulated in the aqueous compartments of an
oil-in-water emulsion (22,23). It has been used to evolve
several classes of nucleic-acid transacting proteins,
including methylases, transcription factors and restriction
enzymes (24–26). A related methodology utilizing
compartmentalization of bacterial cells has also been
*To whom correspondence should be addressed. Tel: +65 6407 0556; Email: fghadessy@p53Lab.a-star.edu.sg
Published online 4 December 2009 Nucleic Acids Research, 2010, Vol. 38, No. 4 e25
doi:10.1093/nar/gkp1089
 The Author(s) 2009. Published by Oxford University Press.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/
by-nc/2.5), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

used to evolve DNA polymerases with tailored properties
(27,28).
In the present study, we demonstrate the use of IVC to
evolve variants of bacteriophage  integrase with altered
site-specificity.  integrase (Int) is the prototypical member
of the large tyrosine-recombinase family that includes Cre
and Flp. Int is central to the bacteriophage lifecycle,
facilitating the controlled integration and excision of its
genome into and out of the host bacterial chromosome,
respectively (29,30). An Int variant, bearing two activating
mutations (E174K/E218K) in the catalytic core domain,
(Int-h/218) has been used in genome manipulation
strategies in mammalian and plant cells, and thus repre-
sents an important tool for a variety of biotechnological
applications (31–33).
Int is a heterobivalent DNA-binding protein able to
catalyze site-specific recombination between a pair of
target sequences, termed att sites, in the absence of
high-energy cofactors (34). The target sequences (attPin
the bacteriophage genome, attB in the bacterial genome)
comprise a pair of 7-bp inverted core-binding sites
separated by a 7-bp ‘overlap’ region (Figure 1). The core
sequence is bound by a subdomain of the large C-terminal
domain of Int [amino acid (aa)-residues 65–356]. In the
much longer attP site, the core sequence is flanked by
binding sites for accessory DNA-bending factors IHF,
FIS and Xis. In addition to these accessory sites, several
‘arm’ binding sites for the N-terminal domain of Int (aa
1–64) also flank the attP core site. These ‘arm’ regions are
essential for activating efficient DNA cleavage by the
C-terminal catalytic domain of Int, and thus contribute
to the regulation of recombination directionality (35,36).
Our results show that one particular Int variant that we
have evolved by IVC is able to recombine a non-cognate
target sequence bearing homology to the attB sequence
(termed attH) more efficiently than the parental enzyme
Int-h/218 recombines attB. Interestingly, the mutations
conferring the altered specificity reside in a region of 
integrase hitherto not implicated in the control of
substrate specificity. Our results thus demonstrate a first
example for a strategy to generate Int variants with altered
specificity, and thus may be applied to enlarge the tool box
for controlled genome manipulations.
MATERIALS AND METHODS
Materials
Oligonucleotides were purchased from First Base
(Singapore); restriction enzymes and T4 polynucleotide
kinase were from NEB; Accuzyme DNA polymerase and
T7 RNA polymerase were from Bioline (UK); DNA puri-
fication kits were from Qiagen and chemical reagents
were from Sigma. The following primers were used:
(i) IntNDE-F: 5
0
-CACACATATGGGAAGAAGG
CGAAGTCATGAGCGC-3
0
(ii) IntECO-R: 5
0
-CTCTGAATTCTCATTATTTG
ATTTCAATTTTGTCCCACTCCCTGCC-3
0
(iii) attB-petF: 5
0
-CTGCTTTTTTATACTAACTTG
GTGATGCCGGCCACGATGCGTC-3
0
(iv) attH-petF: 5
0
-CTGCTTTCTTATACCAAGTG
GATGCCGGCCACGATGCGTC-3
0
(v) aTT-petR: 5
0
-CGCCACAGGTGCGGTTGC
TG-3
0
(vi) Pet-F2: 5
0
-CATCGGTGATGTCGGCGAT-3
0
(vii) Pet-RC: 5
0
-CGGATATAGTTCCTCCTTTCAG
CA-3
0
(viii) pCMVattPH-QC1: 5
0
-CATTTTACGTTTCTCG
TTCAGCTTTCTTATACTAAGTTGGCATTAT
AAAAAAGCATTGC-3
0
(ix) pCMVattPH-QC2: 5
0
-GCAATGCTTTTTTAT
AATGCCAACTTAGTATAAGAAAGCTGAAC
GAGAAACGTAAAATG-3
0
(x) pCMVattP-F3: 5
0
-CCAAAAACGAGGAGGAT
TTG-3
0
(xi) pCMVattP-R1: 5
0
-ACTCAGACAATGCGATG
CAA-3
0
(xii) Int-FRev-R: 5
0
-CATGACTTCGCCTTCTTC
CCAT-3
0
(xiii) IntY342A-QC1: 5
0
-CGGACACCATGGCATCA
CAGGCTCGTGATGACAGAGGCAGGGAG-3
0
(xiv) IntY342A-QC2: 5
0
-CTCCCTGCCTCTGTCAT
CACGAGCCTGTGATGCCATGGTGTCCG-3
0
(xv) IntECOHIS-R: 5
0
-CTCTGAATTCTCATTAGT
GGTGATGGTGATGATGTTTGATTTCAATT
TTGTCCCACTCCCTGCC-3
0
(xvi) IntECO-F: 5
0
-CGGAATTCCGATGGGAAGA
AGGCGAAGTCATGAGCGC-3
0
(xvii) IntXBA-R: 5
0
-GCTCTAGAGCTCAGTGATG
GTGATGGTGATGTAATTTG-3
0
(xviii) attP-PHQC1: 5
0
-CGTTTCTCGTTCAGCTTTC
TTATACCAAGTGGGCATATTAAAAAAGCA
TTGC-3
0
(xix) attP-PHQC2: 5
0
-GCAATGCTTTTTTAATATG
CCCACTTGGTATAAGAAAGCTGAACGAG
AAACG-3
0
(xx) attB-HQC1: 5
0
-AGCTAGCTGAAGCCTGCTT
TCTTATACCAAGTGGAGCGAACGCAATTG
AA-3
0
(xxi) attB-HQC2: 5
0
-TTCAATTGCGTTCGCTCCA
CTTGGTATAAGAAAGCAGGCTTCAGCTA
GCT-3
0
CTGCTTTT T T A T A CTAACTTG
CTGCTTTC T T A T A CCAAGTGG
* **** ****
att H
att B
Core binding
sequence
Overlap
sequence
Core binding
sequence
CAGCTTTT T T A T A CTAAGTTG
CAGCTTTC T T A T A CCAAGTTGattPH
att P
Figure 1. Sequence alignment of the core bacterial attB and human
attH sequences. The 7 bp highlighted in grey represent the overlap
sequence, which must be identical in the respective attP and attPH
recombination partners shown below. The asterisks below the
sequences indicate nucleotides that may interact with integrase (44).
e25 Nucleic Acids Research, 2010, Vol. 38, No. 4 PAGE 2 OF 12

(xxii) Rec-SYBR-F2: 5
0
-AGGTGTCCACTCCCAGG
TC-3
0
(xxiii) Rec-SYBR-R3: 5
0
-CGATCCTCTACGCCGGA
CGC-3
0
(xxiv) Rec-SYBR-HAT 5
0
-CCATACGATGTTCCAG
ATTACGC-3
0
(xxv) SS-F 5
0
-GGCAGGCTTGAGATCTGG-3
0
(xxvi) SYBRgDNA-R: 5
0
-AAGTCAGTCCCATCCCA
GAA-3
0
Vector construction
Integrase cDNA was amplified from the vector pInt-h/218
(37) using primers IntNDE-F and IntECO-R and ligated
into the NdeI/EcoRI sites of pET-22b to generate the
vector pET-Int. The 21-bp attBorattH sites were then
inserted upstream of the integrase gene using primer pairs
attB-petF/att-petR and attH-petF/att-petR, respectively.
Amplified products were phosphorylated using T4
polynucleotide kinase and self-ligated to generate the
vectors pET-attB-Int and pET-attH-Int. A randomly
mutagenized integrase cDNA library was made by
error-prone polymerase chain reaction (PCR) (38,39)
using primers IntNDE-F and IntECO-R and the
parental pInt-h/218 as a template. Sequencing of 12
random library clones indicated that 25% of the clones
had a single missense mutation, 33% had two missense
mutations, 17% had three or more missense mutations
and 25% were wild type (data not shown). None of the
subsequently selected mutations was observed. Library
DNA was restricted and ligated into pET-attH vector
(pET-attH-Int with the parental Int gene removed)
described above. The library was next amplified by PCR
using primers Pet-F2 and Pet-RC to generate linear
DNA templates for selection. The pCMVattPH vector
was constructed by site-directed mutagenesis of the
parental pCMVattPmut plasmid (32) using the
Quikchange mutagenesis system (Stratagene) and
primers pCMVattPH-QC1 and pCMVattPH-QC2.
attPH substrate for selections was generated by PCR
using primers pCMVattP-F3 and pCMVattP-R1 and the
pCMVattPH vector template. Competitor attB and attP
substrates were generated by PCR using primer pairs
pet-F2/IntFRev-R and pCMVattP-F3/pCMVattP-R1
and plasmid templates pET-attB-Int and pCMVattPmut,
respectively. The parental pCMVattPmut plasmid was
additionally modified to enable independent detection of
attB and attH recombination events via real-time PCR
(see below). This was achieved by mutating the PCR
priming site Rec-SYBR-F2 (5
0
-AGGTGTCCACTCCCA
GGTC-3
0
) to Rec-SYBR-HAT (5
0
-CCATACGATGTTC
CAGATTACGC-3
0
) using mutagenic PCR. The inactive
mutant Y342A integrase (40) expression construct was
made by Quickchange mutagenesis of pET-attH-Int
using primers IntY432A-QC1 and IntY342A-QC2. For
purification of recombinant proteins, integrase clones
were subcloned into pET-22b with a C-terminal
hexahistidine tag using primers IntNDE-F and
IntECOHIS-R. For expression in HEK293 cells, integrase
genes were amplified using primers IntECO-F and
IntXBA-R and cloned in the EcoRI/XbaI sites of
pcDNA3.1.
Green-fluorescent protein (GFP)-reporter vectors mea-
suring attH  attPH and attH  attP recombination in cis
were generated by Quickchange mutagenesis of the vector
pIR (32) using primer pairs attB-HQC1/attB-HQC2 and
attP-PHQC-1/attP-PHQC-2.
In vitro selection of integrase mutants
In vitro coupled transcription–translation reactions were
assembled on ice in 50 ml volumes and comprised 37%
(v/v) T7 extract (Novagen), 30 ng (38.1 fmol, 1.5 10
10
integrase variants) mutant library expression template (for
round 1 of selection; 5, 1, 0.5 ng used in subsequent
rounds), 20 ng (50.7 fmol) attPH substrate (for round 1
of selection; 5, 1, 0.5 ng used in subsequent rounds) and
0.5ml (2.5 U) T7 RNA polymerase. Eight-hundred
nanograms each of competing attB and attP substrates
(respectively 4.9 and 2 pmol) (Supplementary Figure S1)
was also added (for rounds 1 and 2 of selection; 1200 ng
were used in rounds 3 and 4). Reactions were emulsified
by dropwise addition of ice-cooled in vitro reaction
mixtures (one drop per 5 s) to 450ml of the oil phase
[4.5% (v/v) Span 80, 0.5% (v/v) Tween-80 in mineral
oil] in a 1.8-ml Cryotube
TM
vial (Nunc) under constant
stirring (1150 r.p.m.) using a magnetic stir bar (8 3 mm,
Jencons). Stirring was continued for 5 min after addition
of the last drop and emulsions incubated at 30

C for
45 min. The emulsion was disrupted by ether extraction
as previously described (25) and the aqueous phase
purified using the DNA Clean & Concentrator
TM
-5 Kit
(Zymo Research). The purified selection products were
amplified by up to three rounds of PCR with the
sequentially nested primer pairs SS-F and PetRC, SS-F
and IntECO-R, Rec-SYBR-F2 and IntECO-R and
ligated into pET-attH as described above. Expression tem-
plates for subsequent rounds of selection were then
amplified via PCR using primers pET-F2 and pET-RC.
After round 4 of selection, the integrase mutant library
was rediversified by staggered extension process (StEP)
PCR shuffling (41) of the four most active clones with
the starting library.
Screening of clones
Clones were screened by in vitro coupled transcription–
translation followed by real-time PCR. The individual
integrase clones coupled to attH were first amplified via
PCR using primers pET-F2 and pET-RC and then
purified using the DNA Clean & Concentrator
TM
-5 Kit
as per manufacturer’s instructions. Each 25 ml reaction
comprised 20 ng of linear attH-integrase construct and
20 ng of linear attPH in the EcoPro
TM
T7 System
(Novagen). Reactions were incubated for 45 min at
37

C. Prior to real-time PCR analysis, all reactions were
purified with the DNA Clean & Concentrator
TM
-5 Kit
PAGE 3 OF 12 Nucleic Acids Research, 2010, Vol. 38, No. 4 e25

and eluted in 12 ml water. Real-time PCR was performed
with 200 nM each of primers Rec-SYBR-F2 and
Rec-SYBR-R3 (to detect for attH attPH recombination)
and primers Rec-SYBR-HAT and Rec-SYBR-R3 (to
detect for attB  attP recombination) using 3 ml of the
eluate in a 20 ml final volume with the SYBR

GreenER
TM
qPCR Supermix for iCycler

(Invitrogen)
on a Bio-Rad iCycler IQ
TM
5. The cycling parameters
were 95

C for 15 s followed by 60

C for 60 s (40 cycles).
Reactions assaying for integration into endogenous attH
in genomic DNA comprised 300 ng EcoRI-restricted
human genomic DNA, 20 ng linear integrase construct
and 10 ng linear attPH substrate in a 25 ml in vitro tran-
scription–translation reaction. Reactions were incubated
and processed as above. The primers used for real-time
quantification were Rec-SYBR-F2 and SYBRgDNA-R.
Western blot analysis
Ten nanograms of linear substrate containing the parental
or mutant integrase genes was combined with the
Novagen EcoPro
TM
T7 extract in a 20 ml reaction, and
incubated for 30 min at 30

C. For western blot analysis,
3 ml of the above reactions was diluted 5 with water and
subsequently size fractionated by sodium dodecyl sulfate
polyacrylamide gel electrophoresis (SDS–PAGE) on 10%
bis-Tris NuPAge gels in MOPS-SDS running buffer
(Invitrogen) at 150 V for 90 min, and transferred to
Hybond-P

PVDF membrane (GE Healthcare) in
NuPage transfer buffer (Invitrogen) with 10% methanol
at 40 V for 60 min at 4

C. The membrane was probed with
rabbit polyclonal to the 6his tag (ab1187, Abcam).
Antibody–protein complexes were identified by
ECL-Plus (Amersham), detected on the Bio-Rad
VersaDoc
TM
Imaging System and quantified using
Quantity One 4.6.5 software.
Protein expression and purification
Two-milliliter cultures of Escherichia coli BL21 (DE3)
cells carrying the various pet22 integrase vectors were
grown for 16 h at 37

C in Luria–Bertani (LB) broth
supplemented with Ampicillin (100mg/ml; Sigma).
One-hundred milliters of fresh LB broth was then
inoculated with 1 ml of these cultures and grown for
2–3 h to an A
600
of 0.5. Integrase expression was
induced with 0.1 mM IPTG (Invitrogen) for 3 h; cultures
were shaken at 30

C during induction. The cells were
pelleted, resuspended in binding buffer [10 mM Tris–HCl
(pH 8), 150 mM NaCl, 10 mM imidazole and protease
inhibitor cocktail tablet; complete mini EDTA free
(Roche)] and lysed by sonication. Cell debris was
removed by centrifugation at 13 000 r.p.m. for 45 min at
4

C. Cleared lysates containing the 6His-tagged
integrase proteins were mixed with 1.5 ml of
nickel-charged resin (Ni–NTA Agarose; QIAGEN)
which had been pre-equilibrated in binding buffer. The
beads were subsequently rotated with the protein
extracts for 3 h at 4

C. The Ni–NTA resins were then
washed six times with chilled wash buffer (PBS + 80 mM
imidazole). Two sequential elution steps were performed,
each with 120 ml of elution buffer [250 mM imidazole,
50 mM Tris–HCl (pH 8), 1 mM DTT, 150 mM NaCl and
10 mM EDTA]. The amount of protein released was
determined using the Quick Start
TM
Bradford Reagent
(Bio-Rad Laboratories) as per manufacturer’s instruc-
tions. The purity of all proteins was determined by
Coomassie Blue staining of polyacrylamide gels
(NuPAGE

Novex 4–12% Bis–Tris Gel; Invitrogen).
In vitro recombination assay for purified proteins
One microgram of purified recombinant integrase protein
was incubated with 200 ng of linear attH substrate and
100 ng of linear attPH substrate for 30 min at 37

Cin
recombination buffer (100 mM Tris pH 7.5, 500 mM
NaCl, 25 mM DTT, 10 mM EDTA, 5 mg/ml bovine
serum albumin). The reaction volume was 25 ml. One
microliter of this reaction was subsequently used for
real-time PCR quantification of recombination efficiency
as described above.
Cell culture and fluorescence-activated cell
sorting analysis
All cell culture reagents and culture plastics were obtained
from Invitrogen/Gibco and Nunc, respectively, unless oth-
erwise specified. Cell cultures were maintained at 37

C
with 5% CO
2
. HEK-293 (ATCC: CRL-1573) cells were
maintained in Dulbecco’s modified Eagle’s medium
(DMEM) supplemented with 10% heat-inactivated fetal
bovine serum (FBS), 2 mM L-glutamine and 1% (v/v) pen-
icillin/streptomycin. Co-transfection of integrase con-
structs in pcDNA 3.1 and pIR reporter plasmid into
293 cells was performed in 6-well plates. Twenty-four
hours before transfection, 293 cells were seeded at a
density of 800 000 cells per well. One microgram of
parental or mutant integrase construct in pcDNA 3.1
was transfected per well, together with 2 mgofpIR
using Lipofectamine 2000 (Invitrogen) as per manufac-
turer’s instructions. All transfections were carried out in
duplicate. Cells were incubated for 48 h prior to FACS
analysis on the Facs Aria (Beckton Dickinson).
Thirty-thousand cells were analyzed for GFP expression.
RESULTS
Selection of j integrase variants with altered binding
specificities by IVC
A search for the presence of the 21-bp sequence
comprising bacterial attB in the human genome returned
no perfect matches (our unpublished data). However, we
identified a 21-bp sequence, termed attH, which differs
from the bacterial attB site at one position in the 7-bp
overlap sequence and three positions in the right arm
(B
0
) core binding sequence (Figure 1). Two of the latter
residues are known to be critical for binding of attBby
wild-type integrase (42). This ‘attH’ site, which is present
e25 Nucleic Acids Research, 2010, Vol. 38, No. 4 PAGE 4 OF 12

in exon 5 of the MCT5 gene (gene accession no.
SLC16A4), was subsequently used as a new target recom-
bination site. We used the previously described  integrase
mutant Int-h/218, subsequently referred to as the
‘parental’ enzyme, to construct a variant library. Int-h/
218 carries the E174K and E218K mutations that enable
 integrase to function in the absence of accessory protein
cofactors and negative supercoiling of attP (43).
The selection strategy schematized in Figure 2A is based
on the ability of in vitro expressed integrase variants to
recombine attPH carrying an adjusted overlap sequence
(provided in trans) with an attH site (Figure 1) tethered
to the integrase expression construct. Emulsification
ensures that an active integrase will only recombine attH
tethered to its encoding gene, thus maintaining the essen-
tial genotype–phenotype linkage. Recombined products
are resolved by PCR amplification using one primer
specific for the integrase cassette and another for the
recombined target DNA, i.e. attPH. Starting with a
library of 1.5 10
10
integrase variants, five rounds of
selection were carried out. In order to direct preferential
recombination of attH and attPH sites, competitor
wild-type recombination substrates attB (100-fold excess)
and attP (40-fold excess) were added. Figure 2B depicts an
example of PCR-rescue of integrase variants capable of
recombining attH and attPH after the first round of selec-
tion. A nested primer pair scoring for recombination, but
not amplifying the complete integrase gene
(Supplementary Figure S2), produced a discrete 500-bp
band indicating correct recombination by library
members (lane 1). Amplification of the complete integrase
gene using a different primer pair also produced the
expected band (1.4 kb), although several other
non-specific products were co-amplified (lane 2). While
inclusion of attB and attP competitor substrates appears
to have a marginal effect (lane 3), the end-point 30-cycle
PCR reaction most likely overrepresents the true recom-
bination level in the presence of competitors. The levels of
these competitors were, however, increased by up to
11 500- and 2400-fold excess over attH and attPH, respec-
tively, in subsequent rounds of selection. Importantly,
recombination was not observed in the absence of tran-
scription/translation (lane 4).
Selected j integrase variants display altered substrate
specificities
Integrase selectants (n= 74) were subjected to a secondary
screen measuring attHxattPH recombination by in vitro
expressed integrase using real-time PCR. Control experi-
ments indicated that the primer pair used only amplified
recombined DNA sequences (Supplementary Figure S3).
In addition, further controls using the inactive Y342A Int
mutant (40) and omitting the Int expression construct
discounted recombination due to activity of a component
in the expression extract (data not shown). Thirty vari-
ants showed improved attH attPH recombination
(Supplementary Figure S4) with the most active (Int1)
giving 7-fold improved efficiency over the parental
Int-h/218 (Figure 3A). Sequence analysis of the six most
active variants revealed each to have between one and six
mutations (Table 1). Several mutations are conserved
between variants, notably I43F and H61R (resident in
the N-terminal ‘arm’ DNA binding domain) and K122R,
present in the core-binding (CB) domain. Interestingly, two
of the mutants consistently showing a strong phenotype
(Int1 and Int5) carry mutations only in the N-terminal
domain. When tested for recombination with an attHx
attP substrate pair, all six mutants showed moderately
reduced recombination efficiency (between 25 and 70% of
Int-h/218), suggesting they have evolved to preferentially
recombine attH attPH with perfectly matched overlap
sequences (Figure 3B). Consistent with this, the mutants
still recombined attH attPH more efficiently than Int-h/
218 in the presence of a 50-fold excess of wild-type attB and
attP sites (Figure 3C).
We next assayed recombination into the attH site present
in EcoRI-restricted human genomic DNA extracted from
HEK293 cells. All six mutants recombined into the
endogenous attH site (attHgen) more proficiently than
Int-h/218 with Int1 and Int5 showing a 9-fold increase
(Figure 3D). Importantly, western analysis showed no dif-
ference in the in vitro expression levels of these two mutants
compared to Int-h/218 (Supplementary Figure S5A).
Altered substrate specificity of recombinant j integrase
variants
In order to discount possible confounding effects of
factors present in the in vitro expression extract, we
purified recombinant Int1 and Int5 proteins
(Supplementary Figure S5B) and assayed their recombi-
nation proficiencies. As shown in Figure 4A, both variants
preferentially recombine attH attPH over attB attPor
the non-matching attH attP pair, which is consistent
with our previous findings. Of note, Int1 recombined
attH attPH 40% more efficiently than Int-h/218
recombined the attB attP pair (Figure 4B). Int5 pro-
cessed the attH attPH pair with the same efficiency as
Int-h/218 recombined its cognate attB attP pair. Taken
together, the data show an additive effect of the I43A and
H61R mutations as the double mutant (Int1) consistently
outperforms the single I43A (Int5) mutant.
Recombination of episomal substrates in HEK293 cells
We next tested recombination by Int1 and Int5 in
HEK293 cells using a reporter construct wherein recom-
bination of att sites flanking an inversely orientated GFP
cassette results in expression of GFP (Supplementary
Figure S6) (32). Consistent with the in vitro phenotype
(Figure 4B), Int1 and Int5 processed the attB attP
substrate less efficiently that In-h/218 (respectively 50%
and 65% activity of Int-218 as measured by FACS
analysis) (Figure 5). Int1 recombined attH attPH
37% more efficiently than attB attP, again in agree-
ment with the in vitro phenotype. While Int-h/218 and
Int1 showed similar efficiencies for attH attPH as
PAGE 5 OF 12 Nucleic Acids Research, 2010, Vol. 38, No. 4 e25

4. Reclone selected
mutant integrase
genes into original
vector
1. Compartmentalization
5a. Repeat cycle
attR
PH O H’
Mut Int
linear attPH
attPH
PH O PH’
attL
H O PH’
linear attH/ Int
expression
fragment
attH
H O H’
Mut Int Lib
+
+
recombination
products
2. Break emulsion
3. PCR rescue
5b. Screen individual
selectants for
recombination efficiency
A
1 2 3 4
500bp -
1500bp -
B
Figure 2. Selection of novel integrase mutants by IVC. (A) Schematic of the IVC protocol for selecting novel integrase mutants. (1) A library of
integrase mutants is constructed using error-prone PCR. Linear mutant integrase expression constructs with appended attH sites are segregated into
the aqueous compartments of a water-in-oil emulsion, together with a separate linear attPH construct. Compartmentalization ensures that after
translation, an active integrase mutant only recombines into the attH sequence appended to it, and not that of other integrase mutants. (2,3,4) The
emulsion is disrupted, and genes encoding the active integrase mutants are amplified by PCR for characterization and further rounds of selection.
PCR primers (arrows) only amplify recombination products containing the genes of integrase mutants capable of performing the attH attPH
recombination event. (B) PCR-rescue of integrase selectants generated by IVC. DNA encoding active integrase mutants was amplified by PCR after
round 1 of the selection. Lanes 1 and 2: integrase mutant library plus attPH substrate. The primer pair used in Lane 1 produces a short 500 bp
amplicon that does not contain the full-length integrase gene, while the pair used in lane 2 produces a longer 1400 bp amplicon that contains the
full-length integrase gene. Lane 3: integrase mutant library plus attPH substrate and competing attB and attP substrates. Lane 4: negative control
selection (identical to lane 3 but with inactive IVC extract). PCR amplification in lanes 2–4 was performed with the same primer pair.
e25 Nucleic Acids Research, 2010, Vol. 38, No. 4 PAGE 6 OF 12

Figure 3. Improved attH attPH recombination efficiency of integrase mutants translated in vitro.(A) The recombination efficiency of 74 integrase
selectants on attP attPH substrates was assayed using real-time PCR (Supplementary Figure S1) and results for the six best clones are shown. All
activities are presented relative to activity of parental Int-h/218 with the attB attP substrates (100%). Error bars indicate standard deviation of two
independent experiments. (B) The efficiency of the six best selectants was also investigated for recombination between the non-cognate attH attP
substrate pair. (C) Recombination efficiency of the six selectants using attH attPH substrates in the presence of 50-fold excess attB and attP
competitors. Recombination of the competing attB. and attP substrates within the same reaction mix was also measured. Activities are presented
relative to activity of parental Int-h/218 with the attP attPH and attB attP substrates (100%). (D) Recombination of endogenous attH site
(attHgen) in genomic DNA by integrase selectants and Int-h/218. Activities are presented relative to activity of parental Int-h/218 (100%).
PAGE 7 OF 12 Nucleic Acids Research, 2010, Vol. 38, No. 4 e25

judged by numbers of GFP-positive cells, the average
GFP intensity for Int5 was 1.6-fold higher, thus indi-
cating improved intracellular substrate processing. Int5
preferentially recombined attB attP over attH attPH
in this assay, which is not consistent with the behavior
of the recombinant purified protein measured for
intermolecular recombination in vitro (Figure 4B). In
order to assay for non-specific recombination by Int1
and Int5 arising from relaxed specificity, we also tested
an attH attP GFP reporter. This substrate was poorly
processed by all the integrases tested (<1% activity, data
not shown).
DISCUSSION
In this article, we have applied IVC to select for integrase
variants with improved recombination activities on a non-
cognate substrate pair. In vitro selection methodologies
are not restricted by transformation efficiencies, and thus
allow the interrogation of exceptionally large variant
libraries for desired phenotypes. IVC, therefore, enabled
us to select from a considerably larger starting library
(1.5 10
10
variants) compared to bacteria-based
recombinase selection systems (1 10
6
variants) (10).
Mutants selected after five rounds showed up to 9-fold
increased recombination of the non-cognate
attH attPH substrate pair, and one particular variant
(Int1) catalyzed recombination more efficiently than the
parental Int-h/218 enzyme recombined the standard
attB attP substrate.
Previous studies have shown relaxed substrate
specificity to be the immediate consequence of selection
pressure for altered specificity in lambda, Flp and Cre
recombinases (10,12,17,18). The Int1 and Int5 mutants
selected here are less proficient at recombining in vitro
both attB attP and the non-matching attH attP
substrate pair when compared to the parental Int-h/218
enzyme. Along with the latter, they are also inefficient at
recombining attH attP in the GFP reporter assay. These
results suggest that the mutational drift is on a pathway
toward a more restricted target site specificity. We antic-
ipate, therefore, that more rounds of IVC with additional
selection pressure (increased competitor substrates and
reduced incubation times) will yield mutants displaying
further restricted specificities.
 Integrase comprises three distinct domains that col-
laborate within a higher-order tetrameric structure to
form a dynamic recombinogenic complex (Figure 6)
(44). The N-terminal DNA-binding domain (residues
1–63) binds ‘arm-type’ DNA sequences flanking the attP
core site. The Int DNA CB (residues 75–175) primarily
recognizes the 7bp attP attB core DNA sequence
motifs and is joined to the C-terminal catalytic domain
(residues 176–356). Binding of the N-domain to arm
sites allosterically modulates the coupled CB and catalytic
domain to increase the affinity to core sites, which ulti-
mately enables DNA strand cleavage and productive
recombination of attB attP (44). Previous studies have
identified mutations in the CB and catalytic domains of 
integrase which impact on recombination site specificity
(17,18). Surprisingly, the mutations in the most active
Table 1. Location and number of mutations present in Int variants selected by IVC
Name Total mutations Mutations
Int1 2 143F H61R
Int2 6 R109G E134G A154V A182T G252L I253L
Int3 2 K122R C262R
Int4 2 E8K H61R
Int5 1 143F
Int6 2 H61R K122R
Figure 4. Improved recombination efficiency of recombinant integrase
mutant proteins. (A) Real-time PCR was used to measure recombina-
tion by integrase enzymes. Recombinant mutant integrase proteins
(Int1, Int5) are more efficient at performing the attH attPH recombi-
nation reaction than recombinant parental integrase protein. They are
also less efficient at recombining the non-cognate attH attP substrate
pair. Activities are presented relative to activity of Int-h/218 on each
substrate pair (100%). (B) The Int1 clone is more efficient at the
attH attPH reaction than the parental integrase is at the attB attP
reaction. Activities are presented relative to activity of Int-h/218 on the
attB attP substrate pair (100%). Error bars indicate standard devia-
tion of two independent experiments.
e25 Nucleic Acids Research, 2010, Vol. 38, No. 4 PAGE 8 OF 12

Figure 5. Preferential recombination of episomal attH attPH substrates in HEK293 cells. Cells were transfected with GFP reporter constructs
assaying attB attP recombination (top panel) or attH attPH recombination (lower panel) along with Int-h/218 and Int1/Int5 expression con-
structs. GFP expression was imaged 48 h post-expression. Cells (n= 30 000) were subsequently analyzed by FACS analysis. The percentage
GFP-positive cells is indicated in upper left of each pane and represents averageSD of two independent experiments.
E8
I43
H61
R109
K122
E134
N
CB
C
Figure 6. Location of selectant mutations in  integrase. Left panel: quaternary structure of the  integrase tetramer bound to core and arm site
DNA. N: N-terminal domain; CB: core-binding domain; C: cayalytic domain. Upper right panel: Selectant mutations mapped onto the N-terminal
domain. Bottom right panel: IVC-selected mutations in the CB domain that are in the vicinity of target DNA. Structures adapted from refs. 44 and
50. Image created using Pymol.
PAGE 9 OF 12 Nucleic Acids Research, 2010, Vol. 38, No. 4 e25

variants identified in our study, I43F and H61R, reside in
the N-terminal domain. Within this domain, neither I43
nor H61 interact directly with arm-site DNA (Figure 6).
I43 resides on an a-helix buttressing a three-stranded
antiparallel B-sheet and flexible N-terminal tail that
interact with the major and minor groove of arm site
DNA, respectively. In the tetrameric structure, it is
orientated away from the DNA toward the opposing
helix of an adjacent Int protomer. Modeling indicates
that mutation to the bulkier phenylalanine potentially
induces a steric clash with I43 of the opposing protomer’s
a-helix (not shown). This may influence the dynamics of
the N-terminal allosteric rearrangement so as to license
the recombination of non-cognate substrates.
Interestingly, the R42L mutant in the closely related
bacteriophage Hong Kong 022 integrase displays
binding to non-cognate core-sites but is recombination
deficient (19). Together, these results indicate a regional
hotspot in the vicinity of I43 that plays a role in
recombinase specificity. The R42L mutant additionally
displays enhanced binding to arm-site DNA. In the
absence of binding to arm-site DNA, the N-terminal
domain intrinsically inhibits binding of  integrase to
core sites (45). The presence of arm-site sequences has
also been shown to increase recombination of core-sites
by Int-h/218 in vivo (32). Enhanced tethering to the
ancillary arm sites might therefore maintain the CB and
catalytic domains in association with non-cognate
substrates for extended periods in order to promote the
assembly and subsequent processing of viable
recombinogenic complexes. It will therefore be worthwhile
assaying the arm-binding affinities of the I43F and other
N-terminal mutants described in this study.
H61 resides in a loop region identified as a potential
swivel about which the N-domains can rotate (46).
While we did not analyze the H61R mutation in isolation,
our data indicate that it potentiates the I43F phenotype.
It may therefore act in concert with I43F to further impact
on the N-domain conformations driving allosteric control
of integrase activity. Furthermore, H61 is proximal to an
a-helical coupler (residues 64–74) that connects to the CB
domain. Mutations in the coupler (L64A in particular)
affect the directionality of recombination to favor
excision over integration (47). The parental enzyme
Int-h/218 shows increased specificity for attB attP deriv-
atives over attL attR, i.e. for integrative over excisive
recombination (48). In our IVC assay, we screened for
the accumulation of intermolecular recombination
products, thus inadvertently further enriching for
mutants with such a phenotype. Further studies
combining coupler mutations along with the mutations
identified here will be useful to delineate potential links
between control of recombination direction and
specificity.
Several mutations present in the CB domain of the
less-active Int2 variant lie in the vicinity of the core site
DNA. Notably, R109 is in contact with the phosphate
backbone of the adenine residue base paired to
thymidine-20 in the attB sequence (Figure 6). Loss of
this contact through mutation to glycine might influence
substrate specificity to tolerate the guanidine present at
this position in attH (Figure 1). Similarly, E134 is in the
vicinity of the cytosine base-paired to the guanidine-21 in
the attB sequence, and mutation to glycine might confer
acceptance of the non-canonical guanidine-20 in attH.
Analysis of these novel mutations in isolation is warranted
in order to further understand their contributions to
substrate specificity.
A subtle difference in substrate type may account for
the weaker attH attPH recombination phenotype dis-
played by Int1 and Int5 in the episomal cell-based assay
when compared with the results obtained in vitro. In the
cell-based assay, recombination occurs in cis, i.e. both att
sites are present on the same DNA molecule. Our selection
strategy employed target sites present in trans and addi-
tionally involved substantial amounts of competitor
DNA. An interesting possibility to be explored further is
that the newly selected Int variants favor intermolecular
over intramolecular recombination. Another possibility
for the observed discrepancy is the reduced dynamic
range inherent to the GFP reporter assay compared to
the real-time PCR quantitation assay. While the mutant
integrases were able to recombine in vitro the endogenous
attH site of purified genomic DNA (Figure 3D), they
could not do so in vivo (data not shown). There are
several possible reasons for this observation. First, as sug-
gested for the weaker phenotype observed in the episomal
recombination assay, the linear attH substrates may not
faithfully mimic the endogenous site, for example, with
respect to higher-order chromatin structure(s). Second,
the MCT5 gene locus may be a transcriptionally sub-
active region, and hence inherently recalcitrant to recom-
bination. Third, it is not known if MCT5 is a dispensable
gene. Further selections utilizing different substrate types
and alternative target sites will shed light on the suitability
of IVC-generated integrases for in vivo applications.
Recombinase engineering thus far has mainly focused
on the Cre and Flp recombinases. Although related to Int,
these enzymes are devoid of an N-terminal domain and do
not require ancillary arm sites for recombination. While
this makes them good candidates for engineering, the
intrinsic predisposition of  integrase toward integrative
over excessive recombination (48) makes it an attractive
enzyme to pursue applications which require inter-
molecular recombination, in particular genomic transgene
insertions. However, future selections using the exception-
ally large Cre and Flp libraries afforded by IVC may also
yield useful variants.
The selection platform detailed here should complement
existing methodologies for generating recombinase
enzymes with novel properties. Furthermore, by being
completely in vitro, the IVC selection platform can poten-
tially be used to engineer other desirable features into
recombinases, such as thermal stability and altered salt/
pH tolerance. These properties cannot be readily engi-
neered using bacterial systems and would be desirable in
e25 Nucleic Acids Research, 2010, Vol. 38, No. 4 PAGE 10 OF 12

reagent tools. In this regard, the improved in vitro recom-
bination by Int1 using the attH  attPH substrate pair
indicates that it may be a useful reagent tool for
recombination-based cloning applications (49).
SUPPLEMENTARY DATA
Supplementary Data are available at NAR Online.
ACKNOWLEDGEMENTS
The authors would like to thank Drs Michael Entzeroth
and William Sun for useful discussions. All experiments
were carried out at the Experimental Therapeutics Centre
(Singapore).
FUNDING
Funding for open access charge: Agency for Science,
Technology and Research (Singapore).
Conflict of interest statement. None declared.
REFERENCES
1. Metzger,D. and Feil,R. (1999) Engineering the mouse genome by
site-specific recombination. Curr. Opin. Biotechnol., 10, 470–476.
2. Nagy,A. (2000) Cre recombinase: the universal reagent for
genome tailoring. Genesis, 26, 99–109.
3. Seibler,J., Schubeler,D., Fiering,S., Groudine,M. and Bode,J.
(1998) DNA cassette exchange in ES cells mediated by Flp
recombinase: an efficient strategy for repeated modification of
tagged loci by marker-free constructs. Biochemistry, 37,
6229–6234.
4. Birling,M.C., Gofflot,F. and Warot,X. (2009) Site-specific
recombinases for manipulation of the mouse genome.
Methods Mol. Biol., 561, 245–263.
5. Irion,S., Luche,H., Gadue,P., Fehling,H.J., Kennedy,M. and
Keller,G. (2007) Identification and targeting of the ROSA26 locus
in human embryonic stem cells. Nat. Biotechnol., 25, 1477–1482.
6. Coates,C.J., Kaminski,J.M., Summers,J.B., Segal,D.J., Miller,A.D.
and Kolb,A.F. (2005) Site-directed genome modification:
derivatives of DNA-modifying enzymes as targeting tools.
Trends Biotechnol., 23, 407–419.
7. Collins,C.H., Yokobayashi,Y., Umeno,D. and Arnold,F.H. (2003)
Engineering proteins that bind, move, make and break DNA.
Curr. Opin. Biotechnol., 14, 665.
8. Zhou,R. and Droge,P. (2006) High-precision surgery in the
genome of human stem cells. Curr. Genomics, 7, 427–433.
9. Sarkar,I., Hauber,I., Hauber,J. and Buchholz,F. (2007) HIV-1
proviral DNA excision using an evolved recombinase. Science,
316, 1912–1915.
10. Buchholz,F. and Stewart,A.F. (2001) Alteration of Cre
recombinase site specificity by substrate-linked protein evolution.
Nat. Biotechnol., 19, 1047–1052.
11. Sclimenti,C.R., Thyagarajan,B. and Calos,M.P. (2001) Directed
evolution of a recombinase for improved genomic integration at a
native human sequence. Nucleic Acids Res., 29, 5044–5051.
12. Bolusani,S., Ma,C.H., Paek,A., Konieczka,J.H., Jayaram,M. and
Voziyanov,Y. (2006) Evolution of variants of yeast site-specific
recombinase Flp that utilize native genomic sequences as
recombination target sites. Nucleic Acids Res., 34, 5259–5269.
13. Akopian,A., He,J., Boocock,M.R. and Stark,W.M. (2003)
Chimeric recombinases with designed DNA sequence recognition.
Proc. Natl Acad. Sci. USA, 100, 8688–8691.
14. Gordley,R.M., Gersbach,C.A. and Barbas,C.F. III. (2009)
Synthesis of programmable integrases. Proc. Natl Acad. Sci. USA,
106, 5053–5058.
15. Porteus,M.H. (2006) Mammalian gene targeting with designed
zinc finger nucleases. Mol. Ther., 13, 438–446.
16. Porteus,M.H. and Carroll,D. (2005) Gene targeting using zinc
finger nucleases. Nat. Biotechnol., 23, 967–973.
17. Dorgai,L., Yagil,E. and Weisberg,R.A. (1995) Identifying
determinants of recombination specificity: construction and
characterization of mutant bacteriophage integrases. J. Mol. Biol.,
252, 178–188.
18. Yagil,E., Dorgai,L. and Weisberg,R.A. (1995) Identifying
determinants of recombination specificity: construction and
characterization of chimeric bacteriophage integrases. J. Mol.
Biol., 252, 163–177.
19. Cheng,Q., Swalla,B.M., Beck,M., Alcaraz,R. Jr, Gumport,R.I.
and Gardner,J.F. (2000) Specificity determinants for
bacteriophage Hong Kong 022 integrase: analysis of mutants with
relaxed core-binding specificities. Mol. Microbiol., 36, 424–436.
20. Buchholz,F., Angrand,P.O. and Stewart,A.F. (1998) Improved
properties of FLP recombinase evolved by cycling mutagenesis.
Nat. Biotechnol., 16, 657–662.
21. Calmels,C., de Soultrait,V.R., Caumont,A., Desjobert,C.,
Faure,A., Fournier,M., Tarrago-Litvak,L. and Parissi,V. (2004)
Biochemical and random mutagenesis analysis of the region
carrying the catalytic E152 amino acid of HIV-1 integrase.
Nucleic Acids Res., 32, 1527–1538.
22. Griffiths,A.D. and Tawfik,D.S. (2006) Miniaturising the
laboratory in emulsion droplets. Trends Biotechnol., 24, 395–402.
23. Tawfik,D.S. and Griffiths,A.D. (1998) Man-made cell-like
compartments for molecular evolution. Nat. Biotechnol., 16,
652–656.
24. Cohen,H.M., Tawfik,D.S. and Griffiths,A.D. (2004) Altering the
sequence specificity of HaeIII methyltransferase by directed
evolution using in vitro compartmentalization. Protein Eng.
Des. Sel., 17, 3–11.
25. Fen,C.X., Coomber,D.W., Lane,D.P. and Ghadessy,F.J. (2007)
Directed evolution of p53 variants with altered DNA-binding
specificities by in vitro compartmentalization. J. Mol. Biol., 371,
1238–1248.
26. Zheng,Y. and Roberts,R.J. (2007) Selection of restriction
endonucleases using artificial cells. Nucleic Acids Res., 35, e83.
27. Ghadessy,F.J., Ong,J.L. and Holliger,P. (2001) Directed evolution
of polymerase function by compartmentalized self-replication.
Proc. Natl Acad. Sci. USA, 98, 4552–4557.
28. Ghadessy,F.J., Ramsay,N., Boudsocq,F., Loakes,D., Brown,A.,
Iwai,S., Vaisman,A., Woodgate,R. and Holliger,P. (2004) Generic
expansion of the substrate spectrum of a DNA polymerase by
directed evolution. Nat. Biotechnol., 22, 755–759.
29. Campbell,A.M. (ed.) (1962), Episomes. Academic Press, New
York.
30. Nash,H.A. (1974) Purification of bacteriophage  Int protein.
Nature, 247, 923–929.
31. Suttie,J.L., Chilton,M. and Que,Q. (2008) US patent no. 7351877.
32. Christ,N., Corona,T. and Droge,P. (2002) Site-specific
recombination in eukaryotic cells mediated by mutant lambda
integrases: implications for synaptic complex formation and the
reactivity of episomal DNA segments. J. Mol. Biol., 319,
305–314.
33. Droge,P. and Enenkel,B. (2005) EP patent no.1565562 (A1).
34. Landy,A. (1989) Dynamic, structural, and regulatory aspects of
lambda site-specific recombination. Annu. Rev. Biochem., 58,
913–949.
35. Radman-Livaja,M., Biswas,T., Ellenberger,T., Landy,A. and
Aihara,H. (2006) DNA arms do the legwork to ensure the
directionality of lambda site-specific recombination. Curr. Opin.
Struct. Biol., 16, 42–50.
36. Radman-Livaja,M., Shaw,C., Azaro,M., Biswas,T., Ellenberger,T.
and Landy,A. (2003) Arm sequences contribute to the
architecture and catalytic function of a lambda integrase-Holliday
junction complex. Mol. Cell, 11, 783–794.
PAGE 11 OF 12 Nucleic Acids Research, 2010, Vol. 38, No. 4 e25

37. Christ,N. and Droge,P. (2002) Genetic manipulation of mouse
embryonic stem cells by mutant lambda integrase. Genesis, 32,
203–208.
38. Vartanian,J.P., Henry,M. and Wain-Hobson,S. (1996)
Hypermutagenic PCR involving all four transitions and a sizeable
proportion of transversions. Nucleic Acids Res., 24, 2627–2631.
39. Zaccolo,M. and Gherardi,E. (1999) The effect of high-frequency
random mutagenesis on in vitro protein evolution: a study on
TEM-1 beta-lactamase. J. Mol. Biol., 285, 775–783.
40. Kazmierczak,R.A., Swalla,B.M., Burgin,A.B., Gumport,R.I. and
Gardner,J.F. (2002) Regulation of site-specific recombination by
the C-terminus of  integrase. Nucleic Acids Res., 30, 5193–5204.
41. Zhao,H., Giver,L., Shao,Z., Affholter,J.A. and Arnold,F.H.
(1998) Molecular evolution by staggered extension process (StEP)
in vitro recombination. Nat. Biotechnol., 16, 258–261.
42. Ross,W. and Landy,A. (1983) Patterns of lambda Int recognition
in the regions of strand exchange. Cell, 33, 261–272.
43. Lorbach,E., Christ,N., Schwikardi,M. and Droge,P. (2000)
Site-specific recombination in human cells catalyzed by phage
lambda integrase mutants. J. Mol. Biol., 296, 1175–1181.
44. Biswas,T., Aihara,H., Radman-Livaja,M., Filman,D., Landy,A.
and Ellenberger,T. (2005) A structural basis for allosteric control
of DNA recombination by lambda integrase. Nature, 435,
1059–1066.
45. Sarkar,D., Radman-Livaja,M. and Landy,A. (2001) The small
DNA binding domain of lambda integrase is a
context-sensitive modulator of recombinase functions. EMBO J.,
20, 1203–1212.
46. Hazelbaker,D., Azaro,M.A. and Landy,A. (2008) A biotin
interference assay highlights two different asymmetric
interaction profiles for lambda integrase arm-type binding sites in
integrative versus excisive recombination. J. Biol. Chem., 283,
12402–12414.
47. Warren,D., Lee,S.Y. and Landy,A. (2005) Mutations in the
amino-terminal domain of lambda-integrase have differential
effects on integrative and excisive recombination. Mol. Microbiol.,
55, 1104–1112.
48. Tan,S.M. and Droge,P. (2005) Comparative analysis of
sequence-specific DNA recombination systems in human
embryonic stem cells. Stem Cells, 23, 868–873.
49. Hartley,J.L., Temple,G.F. and Brasch,M.A. (2000) DNA cloning
using in vitro site-specific recombination. Genome Res., 10,
1788–1795.
50. Fadeev,E.A., Sam,M.D. and Clubb,R.T. (2009) NMR structure of
the amino-terminal domain of the lambda integrase protein in
complex with DNA: immobilization of a flexible tail facilitates
beta-sheet recognition of the major groove. J. Mol. Biol., 388,
682–690.
e25 Nucleic Acids Research, 2010, Vol. 38, No. 4 PAGE 12 OF 12