The beneficial endophyte Trichoderma hamatum isolate DIS 219b promotes growth and delays the onset of the drought response in Theobroma cacao
- DOI: 10.1093/jxb/erp165
- PubMed: 19564160
Abstract
Theobroma cacao (cacao) is cultivated in tropical climates and is exposed to drought stress. The impact of the endophytic fungus Trichoderma hamatum isolate DIS 219b on cacao's response to drought was studied. Colonization by DIS 219b delayed drought-induced changes in stomatal conductance, net photosynthesis, and green fluorescence emissions. The altered expression of 19 expressed sequence tags (ESTs) (seven in leaves and 17 in roots with some overlap) by drought was detected using quantitative real-time reverse transcription PCR. Roots tended to respond earlier to drought than leaves, with the drought-induced changes in expression of seven ESTs being observed after 7 d of withholding water. Changes in gene expression in leaves were not observed until after 10 d of withholding water. DIS 219b colonization delayed the drought-altered expression of all seven ESTs responsive to drought in leaves by 3 d, but had less influence on the expression pattern of the drought-responsive ESTs in roots. DIS 219b colonization had minimal direct influence on the expression of drought-responsive ESTs in 32-d-old seedlings. By contrast, DIS 219b colonization of 9-d-old seedlings altered expression of drought-responsive ESTs, sometimes in patterns opposite of that observed in response to drought. Drought induced an increase in the concentration of many amino acids in cacao leaves, while DIS 219b colonization caused a decrease in aspartic acid and glutamic acid concentrations and an increase in alanine and γ-aminobutyric acid concentrations. With or without exposure to drought conditions, colonization by DIS 219b promoted seedling growth, the most consistent effects being an increase in root fresh weight, root dry weight, and root water content. Colonized seedlings were slower to wilt in response to drought as measured by a decrease in the leaf angle drop. The primary direct effect of DIS 219b colonization was promotion of root growth, regardless of water status, and an increase in water content which it is proposed caused a delay in many aspects of the drought response of cacao.
Author-supplied keywords
The beneficial endophyte Trichoderma hamatum isolate DIS 219b promotes growth and delays the onset of the drought response in Theobroma cacao
doi:10.1093/jxb/erp165 Advance Access publication 29 June, 2009
This paper is available online free of all access charges (see http://jxb.oxfordjournals.org/open_access.html for further details)
RESEARCH PAPER
The beneficial endophyte Trichoderma hamatum isolate DIS
219b promotes growth and delays the onset of the drought
response in Theobroma cacao
Hanhong Bae1,*, Richard C. Sicher1, Moon S. Kim1, Soo-Hyung Kim2, Mary D. Strem1, Rachel L. Melnick3 and
Bryan A. Bailey1,†
1 USDA-ARS-Beltsville Agricultural Research Center, Beltsville, MD 20705, USA
2 College of Forest Resources, UW Botanic Gardens, University of Washington, Box 354115, Seattle, WA 98195, USA
3 Department of Plant Pathology, Pennsylvania State University, University Park, PA 16802, USA
Received 9 February 2009; Revised 9 February 2009; Accepted 29 April 2009
Abstract
Theobroma cacao (cacao) is cultivated in tropical climates and is exposed to drought stress. The impact of the
endophytic fungus Trichoderma hamatum isolate DIS 219b on cacao’s response to drought was studied.
Colonization by DIS 219b delayed drought-induced changes in stomatal conductance, net photosynthesis, and
green fluorescence emissions. The altered expression of 19 expressed sequence tags (ESTs) (seven in leaves and 17
in roots with some overlap) by drought was detected using quantitative real-time reverse transcription PCR. Roots
tended to respond earlier to drought than leaves, with the drought-induced changes in expression of seven ESTs
being observed after 7 d of withholding water. Changes in gene expression in leaves were not observed until after
10 d of withholding water. DIS 219b colonization delayed the drought-altered expression of all seven ESTs
responsive to drought in leaves by >3 d, but had less influence on the expression pattern of the drought-responsive
ESTs in roots. DIS 219b colonization had minimal direct influence on the expression of drought-responsive ESTs in
32-d-old seedlings. By contrast, DIS 219b colonization of 9-d-old seedlings altered expression of drought-responsive
ESTs, sometimes in patterns opposite of that observed in response to drought. Drought induced an increase in the
concentration of many amino acids in cacao leaves, while DIS 219b colonization caused a decrease in aspartic acid
and glutamic acid concentrations and an increase in alanine and g-aminobutyric acid concentrations. With or
without exposure to drought conditions, colonization by DIS 219b promoted seedling growth, the most consistent
effects being an increase in root fresh weight, root dry weight, and root water content. Colonized seedlings were
slower to wilt in response to drought as measured by a decrease in the leaf angle drop. The primary direct effect of
DIS 219b colonization was promotion of root growth, regardless of water status, and an increase in water content
which it is proposed caused a delay in many aspects of the drought response of cacao.
Key words: Drought stress, fungal endophyte, Theobroma cacao, Trichoderma hamatum.
Introduction
Theobroma cacao (cacao), the source of chocolate, is an
understory tropical tree (Wood and Lass, 2001). Cacao is
intolerant to drought (Mohd Razi et al., 1992; Belsky and
Siebert, 2003), and yields and production patterns are
severely affected by periodic droughts and seasonal rainfall
patterns. There is interest in the development of drought
tolerance in cacao through plant breeding and crop
management practices (Belsky and Siebert, 2003).
Cacao trees support a diverse microbial community that
includes many endophytic fungi (Arnold et al., 2003; Rubini
* Present address: School of Biotechnology, Yeungnam University, Geongsan 712-749, Korea.
y To whom correspondence should be addressed. E-mail: bryan.bailey@ars.usda.gov
Published by Oxford University Press [on behalf of the Society for Experimental Biology] 2009.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-
nc/2.0/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
identified isolates of many Trichoderma species that are
endophytic on cacao including above-ground tissues
(Holmes et al., 2004; Bailey et al., 2008). In cacao,
Trichoderma species are primarily being studied for their
ability to control disease (Bastos, 1996; Evans et al., 2003;
Holmes et al., 2006; Bailey et al., 2008). Trichoderma species
are commonly considered as saprophytic inhabitants of soil
but some exist as opportunistic, avirulent plant symbionts
(Wilson, 1997; Harman et al., 2004). Beneficial activities
attributed to Trichoderma/plant interactions include induced
disease resistance, plant growth promotion, and tolerance of
abiotic stresses including drought (Harman et al., 2004).
Several classes of endophytic microorganisms, in addition
to Trichoderma species, are known to alter the response of
plants to abiotic stresses. Endophytes of cool-season grasses
have been studied for their ability to induce tolerance
to multiple biotic and abiotic stresses (Malinowski and
Belesky, 2000). Some of the mechanisms used by the cool-
season grass endophytes to alter the drought response
include drought avoidance through morphological adapta-
tions, drought tolerance through physiological and bio-
chemical adaptations, and enhanced drought recovery
(Malinowski and Belesky, 2000). Mycorrhiza also alter the
response of plants to abiotic stresses (Auge´, 2001). Of the
many possible mechanisms employed by mycorrhiza to
enhance drought tolerance, the most studied mechanism
relates to enhanced growth and is commonly associated
with increased phosphorous acquisition (Auge´, 2001).
Evidence supports several mechanisms as being important
in Trichoderma-induced plant growth promotion including
enhanced nutrient uptake and inhibition of deleterious root
microflora (Harman et al., 2004).
Recently, Bailey et al. (2006) characterized the interactions
between four Trichoderma species and cacao at the molecular
level. The observed changes in gene expression patterns in
these Trichoderma/cacao interactions raised the possibility
that Trichoderma species could induce tolerance to abiotic
stresses, possibly including drought, in cacao. The objective
was to characterize the effect of endophytic colonization of
cacao by Trichoderma hamatum isolate DIS 219b on the
responses of cacao to drought. Colonization of cacao
seedlings resulted in a delay in many aspects of the drought
response. It is proposed that this effect is mediated through
enhanced root growth, resulting in an improved water status
allowing cacao seedlings to tolerate drought stress.
Materials and methods
Trichoderma inoculation
Trichoderma hamatum isolate DIS 219b was isolated from
a pod of Theobroma gileri in Guadual, Lita, Esmeraldas
Province, Ecuador (Evans et al., 2003). DIS 219b was
grown on cornmeal dextrose agar plates at 23 C for 5
d without light before use. Two agar plugs (0.5 cm in
diameter) were added to a soilless mix (2:2:1, sand:perlite:
promix), in double magenta boxes (773773194 mm;
Magenta, Chicago, IL, USA). The magenta boxes con-
tained 9 cm sterile soilless mix and had four holes (0.5 cm
diameter) sealed with tape on the bottom. Sterile water
(25 ml) was added to the soilless mix at the time of
inoculation. The magenta boxes were maintained in growth
chambers as described below for 14 d before being planted
with cacao seed.
Plant materials
Seeds of Theobroma cacao variety comun (Lower Amazon
Amelonado type) were obtained from the Almirante Cacau,
Inc. farm (Itabuna, Bahia, Brazil). After removal of the seed
coat, seeds were surface sterilized in 14% sodium hypochlo-
rite for 3 min and then washed three times with sterile
distilled water. Sterilized seeds were germinated on 1.5%
water agar plates under fluorescent lights for 3 d at 22 C.
The germinated seeds were planted 3 cm deep into the
sterile soilless mix in double magenta boxes with or without
DIS 219b.
Phenotypic and molecular analyses of the cacao
drought response
Magenta box-grown seedlings were produced as described
above and grown in a controlled environment chamber
(model M-2; EGC Corp., Chagrin Falls, OH, USA) with
the following conditions: 12-h light/12-h dark photoperiod
at 25 C, 50% relative humidity, and 50 lmol m2 s1
photosynthetically active radiation (PAR). The upper boxes
and tape on the lower boxes were removed after 2 weeks.
Seedlings were watered every other day for 32 d of growth
in the magenta boxes. Before altering the watering cycles,
the length of the hypocotyls and epicotyls for the non-
colonized and colonized seedlings were measured. Watering
was stopped for 13 d for the drought treatment, while
control seedlings continued to be watered every other day.
Six independent seedlings were harvested for each treatment
combination (plus and minus DIS 219b and plus and minus
drought) at 0, 7, 10, and 13 d after initiating the drought
treatment. Roots and the largest leaves were harvested for
quantitative real-time reverse transcription PCR (qPCR)
analysis. A second leaf was harvested for fluorescence image
analysis.
Direct effects of DIS 219b on gene expression in
9-d-old cacao seedlings
To assess further the direct effects of DIS 219b on gene
expression in 9-d-old seedlings, expression patterns of tran-
scripts were analysed using primers for newly identified
drought-responsive expressed sequence tags (ESTs). The
methods which have been described previously include pre-
germination of sterile cacao seed on water agar for 3 d and
colonization of the resulting seedlings for 6 d by four
Trichoderma isolates including DIS 219b (Bailey et al., 2006).
The seedlings were frozen in liquid nitrogen and total RNA
was isolated from the whole seedlings minus the cotyledons.
3280 | Bae et al.
Total RNA was isolated from cacao seedlings as described
by Bailey et al. (2005). Procedures for qPCR and analysis
were as described by Bae et al. (2008). To obtain the relative
transcript levels, the threshold cycle (CT) values for all genes
of interest (CTdGOI) were normalized to the CT values of
ACT (CTdACT) for each replication [DCT¼(CTdACT)–
(CTdGOI)]. Relative transcript levels were calculated with
respect to cacao ACTIN transcript levels (% of ACTIN).
The fold changes in transcript were obtained from the
following equation: fold change¼[(E) DCT] as described
previously by Pfaffl (2001). Average values were calculated
from six biological replications and the error bars indicate
the standard error of the mean. The sequence information of
the 20 primer sets used, including Actin, is given in Table 1.
Measurement of leaf gas exchange and leaf water
potential
Net photosynthesis (Pn) and stomatal conductance (gs) were
measured using a portable photosynthesis system (LI-6400;
LI-COR, Inc., Lincoln, NE, USA) with a leaf chamber
fluorometer (LI6400-40). All measurements were made
under the following conditions: 300 lmol m2 s1 (PAR),
25.9 C (leaf temperature), 1.13 kPa (vapour pressure
deficit), 400 lmol mol1 (CO2).
Table 1. Primer sequences used for qPCR analysis in cacao
Putative gene function
(EST designation)
Accession
no.
Sequence (5# to 3#)a Expected
size (bp)
Max identities/E-value
(accession no.)
Rubisco small subunit (TcrbcS) CF973934 F: GAACCTCAGGATACCTGGGTACTAT 241 79/3E-90 (Y07779)
R: GTCCCTACAAGGGAACAAGTCTAAT
ATP-binding cassette transporter (TcABC-T) CF974185 F: ACAGCTTCAATTACCTGACTCCAT 217 59/2E-57 (AY734542)
R: TAGTCCACTAGTAGGCTCATCAAGG
Histidine kinase (TcHK) CF972897 F: GCACTAATCACATCAGCTCCATACT 243 83/3E-85 (AJ298990)
R: TACTTCTGGTGTTTGTAACTTGACC
Receptor-like protein kinase (TcRPK) CF973313 F: TCCAGAGAATGCATTTACAACTACC 232 70/5E-49 (U77888)
R: CTGATACCTGATCTCTGATTCCAGT
MAP kinase 3 (TcMAPK3) CF974368 F: TGAATAGAAAGCCTCTATTTCCTGG 204 86/1E-88 (AF153061)
R: GAGATCAATAGCCAATGGATGAAC
MAP kinase kinase 4 (TcMKK4) CF974565 F: CAAGCTCCATATATCTCCAAGGTAA 239 74/1E-73 (AY691333)
R: CTTGCCTTACTTACATGCCCATA
Serine/threonine kinases/receptor kinase (TcSTK) CF973647 F: ACTTCAATATCTCCAGCAAGCATAG 230 67/4E-67 (NM104491)
R: CCAAACTCTGACAATAGCCTAGAAA
Senescence-associated protein (TcSEN1) CF973886 F: ATACCCTCCAGCAATGTCTGTAAC 237 71/1E-57 (DQ116561)
R: AGGACTCCTGAAGAGTTCAGTGC
Cellulose synthase 3 (TcCESA3) CA798419 F: CCCACCAACTACTCTCCTCATTAT 208 96/4E-74 (AY221087)
R: CAGAATCGACCATACGACAACAAT
Protein phosphatase 2C (TcPP2C) CF972808 F: ACAGCTTCTTGATTGCTTAGGTG 215 90/2E-90 (AJ277744)
R: TACAGGTTTCCTAGATCTATCGGTG
Allene oxide cyclase (TcAOC) CF973875 F: CTTTAGACTGAAAAAGCTGGCATAG 247 78/4E-41 (AB095986)
R: CAGGTTAAGCTGCAGCAAATTGT
Lipoxygenase (TcLOX) CF973956 F: ACATACTCAGTCACCCATTGTTTG 218 69/4E-86 (X96405)
R: TTGGCCAAGTATTATCTAGAGGTTG
Trehalose-6-phosophate phosphatase (TcTPP) CA796499 F: CAATTTATATTGGAGACGACAGGAC 204 76/2E-69 (AY570725)
R: GCTCCTAATTTCTTCAAGCTTCTTC
Pathogenesis-related protein 5 (TcPR5) AY766059 F: ATTAGATGCACGGCAGATATCATAG 242 79/9E-121 (AF364864)
R: CAGAACACAACCCTGTAGTTAGTCC
Neutral invertase (TcNI) CF974742 F: GACAGGCATAAGTCTGATCCTTAAT 228 84/2E-81 (Y16262)
R: CTATAAGGACAAAGCAAAGCAAGG
Sorbitol transporter (TcSOT) CF974712 F: AGTAATTCTTTCCAGACGCCTTC 229 81/1E-62 (AB125648)
R: TCTTGGCTATTGGTGTTATAGCG
Nitrate reductase (TcNR) CF974302 F: ATGACTTGATAAATTGGCGTGATAC 120 96/7E-29 (AY138811)
R: TTTGGGTCACATTGAATATACGTG
Zinc finger binding protein (TcZFP, TcP13) DW246138 F: CGATAAACATCGTTGTGGATCTGTA 230 88/2E-39 (AJ632084)
R: ATAACGATACTAAAGTTCGCTTCGC
Tonoplast intrinsic protein (TcTIP, TcP31) DW246146 F: GAAAGGTAACATTGGGATCATTGC 216 81/5E-70 (DQ202710)
R: ATGAAGAAGATCTCATAGACAACGG
Actin (TcACT) CF973918 F: CAGACTTTGAGTTCACTTGACACAG 200 85/1E-30 (AY305729)
R: AGTGTCTGGATTGGAGGATCTATCT
a F, Forward; R, reverse.
Trichoderma delays the onset of the drought response in cacao | 3281
Multispectral fluorescence images from the third largest
cacao leaves were obtained as described by Kim et al.
(2003). The excitation light source was as follows: four 12
W, long-wave UV-A fluorescent lamps (Model XX-15A;
Spectronics Corp., New York, NY, USA), 0.33 mW cm2
intensity with an emission max at 360 nm in the target area.
The radiation from the UV lamps was filtered with Schott
UG-1 glass to eliminate wavelengths >400 nm. A back-
illuminated and thermoelectrically cooled CCD camera
(PixelVision, OR, USA) was used to capture the fluores-
cence images. A Nikon f 1.4/35 mm lens was coupled to
a common aperture multispectral adapter (MSAI-04; Opti-
cal Insights, AZ, USA) to collect the fluorescence emissions.
Blue and green filters were used in this study: 450 nm with
a 25 nm full width at half maximum (FWHM) and 530 nm
with a 25 nm FWHM, respectively.
Metabolite measurement
Seedlings in magenta boxes (six seedlings per treatment)
were grown in a controlled environment chamber as de-
scribed above. Seedlings were watered every other day for
32 d of growth in the magenta boxes after which the
watering cycle was altered. The watering cycle was then
changed to 3 d or 13 d and maintained for 13 d. The mature
first flush leaves were harvested separately for each seedling
and frozen in liquid nitrogen, lyophilized, and dry weights
obtained prior to carbohydrate and amino acid analysis.
For amino acid analysis, leaf samples were ground to a fine
powder in a mortar and pestle using liquid nitrogen. Fifty
milligrams of each lyophilized sample were extracted with 2 ml
of 70% aqueous methanol in a ground-glass tissue homogenizer.
The homogenates were incubated in a H2O bath at 45 C for
15 min, centrifuged for 15 min at 5800 g, and the supernatants
were evaporated to dryness under a stream of N2 at 37 C.
Samples were resuspended in 0.5 ml of 20 mM HCl and
filtered using a 0.22 lm Ultrafree-MC membrane filter unit
(Millipore Corp., Bedford, MA, USA). Soluble amino acids
were determined by HPLC using the AccQTag pre-column
derivatization method (Waters Corp., Milford, MA, USA).
Separations were performed using a Waters 600E Multisolvent
Delivery System equipped with a 3.93150 mm AccQTag C18
column. The elution gradient, based on recommendations in
the AccQFluor kit, used a pH of 5.0 and a column tempera-
ture of 37 C. Detection was with a Gilson 121 fluorometer
using excitation and emission wavelengths of 250 nm and 395
nm, respectively. The detector output was monitored using
Empower2 software from Waters and standard curves were
prepared with known mixtures of amino acids.
For carbohydrate analysis, leaf tissue (50 mg of lyophilized
tissue) was extracted twice with 1 ml of 80% ethanol in
ground-glass tissue homogenizers at 4 C. The homogenates
were transferred to 15 ml conical tubes and centrifuged at
4000 g for 15 min. The pellets were washed with 1 ml of 80%
ethanol and centrifuged as above. The supernatant fractions
were combined and the extracts were evaporated to dryness
under N2 at 37 C. The dried samples were reconstituted in
1 ml of deionized H2O and transferred to a sealed cryovial
for storage at –20 C. Pellets were gelatinized in 2 ml boiling
H2O for 30 min and leaf starch was hydrolysed by the action
of a-amylase and amyloglucosidase. Soluble sugars and
glucose from starch were quantified spectrophotometrically
in coupled enzyme assays (Sicher, 2001).
Biomass and metabolite analyses of the cacao drought
response
Seedlings in magenta boxes were grown in a controlled
environment chamber (model M-2, EGCCorp., Chagrin Falls,
OH, USA) with the following conditions: 12 h light/12 h dark
photoperiod at 25 C and 90 lmol m2 s1 PAR. The upper
boxes and tape on the bottoms were removed after 2 weeks.
In the initial experiment, carried out at 80% humidity,
seedlings were watered every other day for 32 d of growth.
The watering cycle was then changed to 1, 3, 7, or 10 d and
maintained for 21 d. Leaf production by cacao seedlings
proceeds in cycles (flushes) of two to four new leaves at
a time. The first flush leaves were harvested separately for
each seedling and frozen in liquid nitrogen. The stem and
second flush leaves were harvested and weighed. The roots of
each seedling were collected, washed, dried on paper towels,
and weighed. After measuring fresh weights, the tissues were
oven dried (50 C for 7 d) and dry weights were determined.
In the second experiment, carried out at 40% humidity,
seedlings were watered every other day for 32 d of growth,
after which the watering cycle was altered. The watering cycle
was then changed to 3 d or 5 d and maintained for 15 d. At the
end of each 5 d cycle leaf angles were measured. Leaf angle
was determined as the drop of the leaf blade tip from
horizontal using a protractor. The maximum drop in leaf
angle was set at 90. The stem, first flush leaves, and second
flush leaves were harvested separately for each seedling and
weighed. The roots of each seedling were collected, washed,
dried on paper towels, and weighed. The tissues were then
oven dried (50 C for 7 d) and dry weights were determined.
Statistical analysis
Data for biomass, carbohydrates, amino acids, stomatal
conductance, and net photosynthesis were statistically
analysed for significance using the general linear model
PROC GLM analysis, followed by a Tukey test using the
SAS program (SAS Institute Inc., Raleigh, NC, USA). A
95% confidence level was used for all analyses, so that
P <0.05 was considered to be significant.
Results
Physiological and fluorescence image data
Prior to the shift in watering cycles at 32 d, cacao seedlings
treated with DIS 219b had taller hypocotyls (Fig. 1A). After
withholding water for 13 d, the leaves of cacao seedlings not
3282 | Bae et al.
those of cacao seedlings colonized by DIS 219b (Fig. 1B).
Net photosynthesis and stomatal conductance were signifi-
cantly reduced as the time without water increased from 7
d to 13 d (Table 2). Treatment with DIS 219b suppressed
the reduction in net photosynthesis and stomatal conduc-
tance (Table 2). The interaction between drought and DIS
219b treatment was not significant. Values for stomatal
conductance were reduced due to drought by 48% 7 d post-
watering (PW) (Table 2) and to 96% 13 d PW. Net
photosynthesis was reduced due to drought by 29% 7 d PW
and to 96% 13 d PW (Table 2). Non-colonized seedlings
averaged an 85% reduction in stomatal conductance and
a 76% reduction in net photosynthesis across the 7, 10, and
13 d watering cycles compared with the 3 d watering cycle.
The DIS 219b-colonized seedlings averaged a 64% reduc-
tion in stomatal conductance and 46% reduction in net
photosynthesis across the same watering cycles.
Increased leaf fluorescence was observed in the green
(F530) spectral range starting 10 d PW in non-colonized
seedlings (Fig. 2). The fluorescence emissions of adaxial leaf
surfaces of non-colonized seedlings increased 26% and 22%
over that of colonized seedlings 10 d and 13 d PW,
respectively. Pair-wise comparisons of the relative intensities
for the green fluorescence band at 530 nm were significantly
different at a¼0.05 at 10 d and 13 d PW.
Drought-induced changes in transcripts levels
Changes of transcript levels were monitored during drought
treatment in leaves and roots of cacao seedlings (Figs 3–6).
Nineteen ESTs (Table 1) were identified as responsive to
drought in leaves and/or roots of cacao. The transcript level
of TcrbcS declined at 10 d PW by 74% in non-colonized
seedlings compared with a decline of only 39% in colonized
seedlings (Fig. 3).
TcSOT, TcPR5, and TcNI were induced by drought
starting at 10 d PW in leaves (Fig. 4A). TcTPP was also
induced by drought but not until 13 d PW in leaves (Fig.
4A). TcTPP and TcSOT were induced by drought starting
at 7 d PW in roots (Fig. 4B), while TcPR5 was induced by
drought starting at 10 d PW (Fig. 4B). TcCES3 was
repressed by drought in roots (Fig. 4B). The change in gene
expression in response to drought was delayed in colonized
Table 2. The effect of drought and DIS 219b colonization on
stomatal conductance (gs) and net photosynthesis (Pn)
The readings for the non-colonized seedlings at 7, 10, and 13 d PW
were divided by the readings for 3 d watered non-colonized
seedlings at those same time points, and the readings for the DIS
219b-colonized seedlings at 7, 10, and 13 d PW were divided by the
readings for 3 d watered DIS 219b-colonized seedlings at those
same time points within each replication. These values were
subtracted from 1 and multiplied by 100 to determine percentage
reduction. Statistical analysis was carried out as described in the
text. The interaction between drought and Trichoderma was not
significant so means are presented for drought effect over both
Trichoderma treatments (colonized or non-colonized) and for the
Trichoderma effect over all drought treatment time points (7, 10, and
13 d).
Treatment % reduction
gs Pn
Drought effect
7 d 48 Ba 29 Ca
10 d 82 AB 63 B
13 d 96 A 96 A
Trichoderma effect
Non-colonized 85 A 76 A
DIS 219b-colonized 64 B 46 B
a Means within columns for the individual treatments of drought or
Trichoderma followed by the same letter are not significantly different
at the P <0.05 level.
Fig. 1. The effect of drought and DIS 219b colonization on cacao
seedling growth. Seedlings were grown in magenta boxes in
a controlled environment chamber (model M-2; EGC Corp.,
Chagrin Falls, OH, USA) with the following conditions: 12 h light/12
h dark photoperiod at 25 C, 50% relative humidity, and 50 lmol
m2 s1 PAR. The seedlings were either colonized with
Trichoderma hamatum isolate DIS 219b or not colonized (Control).
After emergence, seedlings were watered every other day for 32
d of growth in the magenta boxes. Before altering the watering
cycles, the length of the hypocotyls for the non-colonized and
colonized seedlings were measured. After 32 d of growth, water-
ing was stopped for 13 d (drought treatment), while control
seedlings continued to be watered every other day. (A) Hypocotyl
length after 32 d of growth without drought treatment. Bars show
means 6standard error. (B) The photograph of the seedlings was
taken after water was withheld for 13 d.
Trichoderma delays the onset of the drought response in cacao | 3283
(Fig. 4A) and for TcPR5 and TcCESA3 in roots (Fig. 4B).
In roots, drought-induced TcLOX and TcSEN1 (Fig. 5).
TcAOC, TcABC-T, TcTIP, and TcNR were repressed by
drought treatment 10 d PW (Fig. 5). DIS 219b colonization
did not alter the drought-induced changes in TcAOC,
TcLOX, TcABC-T, TcNR, or TcSEN1 (Fig. 5).
TcMAPK3 and TcZFP were induced by drought in leaves
of non-colonized seedlings (Fig. 6). The induction of
TcMAPK3 and TcZFP by drought in leaves was delayed in
DIS 219b-colonized seedlings. In roots, drought induced
expression of TcHK, TcMAPK3, TcPP2C, and TcZFP, and
repressed expression of TcRPK, TcMKK4, and TcSTK
(Fig. 6). Colonization by DIS 219b delayed the drought
induction of TcMAPK3 and TcZFP in roots.
Direct effects of DIS 219b gene expression in 9-d-old
cacao seedlings
RNA isolated from 9-d-old seedlings (DIS 219b-colonized
and non-colonized) grown on agar plates during a pre-
viously published study (Bailey et al., 2006) was used to
study further the early influence of DIS 219b colonization
on expression of drought-responsive ESTs identified in
research first presented here. TcHK and TcMAPK3, in-
ducible by drought, were also induced by DIS 219b
colonization (Fig. 7). Also significant was the observed
induction of TcSTK and TcMKK4, and TcNR, ESTs that
were repressed by drought (Fig. 7). TcNR was the most
highly induced DIS 219b-responsive EST (1200-fold
induced).
Changes in carbohydrates and soluble amino acids
Mean foliar starch and sucrose concentrations did not
change significantly in response to water cycle or DIS 219b
colonization. Glucose accumulated in response to the 13
d water cycle (Table 3). Total amino acid content increased
in response to the 13 d water cycle, but not to DIS 219b
colonization (Table 3). The concentrations of His, Arg, Pro,
c-aminobutyric acid (GABA), Val, and Leu increased
significantly in response to the 13 d water cycle (Table 3).
For DIS 219b-colonized seedlings, the concentrations of
Ala and GABA increased, while the concentrations of Asp
and Glu were reduced compared with non-colonized seed-
lings (Table 3). The concentration of Asp increased
significantly in response to the 13 d water cycle only in
Fig. 2. Representative fluorescence responses of cacao leaves
during drought treatment (0, 10, and 13 d without watering) of
non-colonized (Control) and colonized (DIS 219b) cacao seedlings.
Seedlings were watered every other day for 32 d of growth. After
32 d of growth, watering was withheld for 13 d. Fluorescence
emissions of adaxial surfaces of cacao leaves at 530 nm (F530)
were measured using six biological replications. Relative fluores-
cence intensity is given in the vertical colour scale in the middle.
Days after treatment
0 7 10 13
%
T
cr
bc
S
/ A
C
T
0
2500
5000
7500
Control (water)
Control (no water)
219b (water)
219b (no water)
Fig. 3. Expression pattern for EST TcrbcS (putative Rubisco small
subunit). Seedlings were watered every other day for 32 d of
growth before drought treatment. The largest leaves were
harvested 0, 7, 10, and 13 d after the last watering. Treatments:
Control (water), non-colonized seedlings watered every other day;
Control (no water), non-colonized seedlings with water withheld
13 d; 219b (water), colonized seedlings watered every 2 d; 219b
(no water), colonized seedlings with water withheld 13 d. Relative
mRNA levels were calculated for qPCR results with respect to
ACTIN transcripts (% of ACTIN). Bars show means 6standard
error (n¼6).
3284 | Bae et al.
associated with an increase in root fresh weight, root dry
weight, and root water weight, regardless of the watering
cycle.
In a second biomass study, fresh weights, dry weights,
and water weights of roots, tops (leaves and stems), and
total seedlings were determined using non-colonized and
DIS 219b-colonized seedlings on 3 d and 5 d watering cycles
(Table 5). In addition, the ratio of root dry weight to top
dry weight was determined. Leaf angle was measured at the
end of each 5 d watering cycle. In this study the humidity
was maintained at 40%. Only data where DIS 219b effect or
its interaction with drought was significant are presented.
During the experiment, some seedlings died under the 5 d
watering cycle treatment and the weights of their tissues
were not included in the statistical analysis. Limiting water-
ing from a 3 d to a 5 d cycle caused a reduction in root fresh
weight and root dry weight, total fresh weight, root water
weight, and total water weight, along with an increase in the
root dry weight/top dry weight ratio. DIS 219b colonization
resulted in an increase in the root fresh weight, root dry
weight, total fresh weight, root water weight, and total
water weight, along with an increase in the root dry weight/
top dry weight ratio. The water cycle3DIS 219b treatment
interaction was significant for top fresh weight, top dry
weight, and total dry weight. For all three measurements,
DIS 219b colonization was associated with an increase in
weight under the 3 d watering cycle but not for the 5
d watering cycle. Top fresh weight, top dry weight, and
total dry weight decreased in response to the 5 d watering
cycle regardless of DIS 219b treatment.
By separating each seedling into 0.05 g weight class
increments based on root dry weight, it is apparent that,
for the 3 d watering cycle, DIS 219b seedlings dominated
the two heaviest weight classes (0.5 g dry weight and larger)
(Fig. 8). For the 5 d watering cycle, DIS 219b-colonized
seedlings dominated the 0.55 g and larger weight class but
seedlings in the 0.5–0.54 g weight class were lost to smaller
weight classes and some seedlings died. The non-colonized
seedlings dominated the dead class with 2.5 seedlings per
block dying compared with one seedling per block for the
DIS 219b-colonized seedlings.
Leaf angle was measured at the end of each 5 d watering
cycle (Table 6). After cycle 1, drought caused a significant
increase in the leaf angle drop and the DIS 219b effect was
not significant, although it tended towards reducing the
degree of drop. After the second and third watering cycle,
drought again caused an increase in the leaf angle drop, and
%
Tc
A
O
C
/
A
C
T
0.0
1.5
3.0
4.5
Control (water)
Control (no water)
219b (water)
219b (no water)
%
Tc
LO
X
/ A
C
T
0.00
0.03
0.06
0.09
0.12
%
Tc
A
B
C
-T
/
A
C
T
0.00
0.25
0.50
0.75
%
Tc
TI
P
/ A
C
T
0
25
50
75
%
Tc
N
R
/
A
C
T
0.0
0.4
0.8
1.2
1.6
Days after treatment
%
Tc
SE
N
1
/ A
C
T
0
2
4
6
8
0 7 10 13
Fig. 5. Expression patterns in roots for ESTs putatively involved in
hormone production (TcAOC, TcLOX), membrane function
(TcABC-T, TcTIP), and other physiological processes (TcNR,
TcSEN1). Treatments: Control (water), non-colonized seedlings
watered every other day; Control (no water), non-colonized seed-
lings with water withheld 13 d; 219b (water), colonized seedlings
watered every 2 d; 219b (no water), colonized seedlings with water
withheld 13 d. Relative mRNA levels were calculated for qPCR
results with respect to ACTIN transcripts (% of ACTIN). Bars show
means 6standard error (n¼6).
3286 | Bae et al.
colonized seedling compared with non-colonized seedlings.
Discussion
Induced effects on cacao physiology and the drought
response
During drought, plants can show the following symptoms:
cessation of shoot growth, decreased stomatal conductance,
reduced net CO2 assimilation, impaired photosynthesis,
accumulation of solutes, cessation of root growth, and leaf
senescence and plant decline (reviewed by Passioura, 1996).
In addition, the blue-green fluorescence of plants often
increases in response to drought (Lichtenthaler and Miehe´,
1997; Buschmann et al., 2000; Hideg et al., 2002). Pre-
viously, aspects of the drought response of cacao related to
expression of genes involved in polyamine biosynthesis were
described (Bae et al., 2008). Here it is shown that the
drought-induced changes in net photosynthesis and stoma-
tal conductance were delayed in DIS 219b-colonized seed-
lings (Table 2). The change in fluorescence emissions of
cacao leaves was greater for non-colonized seedlings than
colonized seedlings at 10 d and 13 d PW (Fig. 2).
The impact of endophytes on the plant drought response
has been intensely studied in cool-season grasses (reviewed by
Malinowski and Belesky, 2000). Endophyte-infected tall
fescue showed improved tolerance to drought and faster
recovery after a drought period. The cool-season grass
endophytes often cause their plant host to respond to drought
earlier, resulting in accelerated stomatal closure and reduced
water loss (Malinowski and Belesky, 2000). However,
a delayed drop in stomatal conductance and net photosyn-
thesis due to drought was observed in colonized seedlings.
Plants colonized by vesicular-arbuscular microrrhizae (VAM)
under drought conditions can maintain stomatal conductance
and leaf water potential (Davies et al., 1996; Auge´, 2001),
which resembles the responses of DIS 219b-colonized cacao
seedlings to drought. The primary impact of VAM on plant–
water relationships has been attributed to changes in plant
growth and development and is commonly associated with
enhanced phosphorus acquisition (Auge´, 2001).
Table 3. The effect of water cycle and Trichoderma colonization
on carbohydrate and amino acid concentrations in cacao leaves
Treatments were: colonized (219b) or non-colonized seedlings (Cont)
watered every three days; colonized (219b) or non-colonized seed-
lings (Cont) with watering withheld 13 days. Statistical analysis was
carried out as described in the text. Means are presented for water
cycle effect over both Trichoderma treatments and for the Tricho-
derma effect over both water cycle treatments. The interaction
between water cycle and Trichoderma was significant for ASP and
LYS only and these are discussed in the text.
Metabolite Water cycle effect Trichoderma effect
3 day 13 day Cont 219b
–lmol g1 DW– SIGa –lmol g1 DW– SIG
Starch 403 386 413 375
Glucose 113 126 * 114 120
Sucrose 104 101 99 106
–pmol g1 FW– SIGa –pmol g1 FW– SIG
ASP 1430 1789 * 1799 1421 *
SER 763 983 850 884
GLU 3268 2670 3470 2536 *
GLY 422 660 474 593
HIS 354 821 * 494 653
ARG 879 1095 * 1033 936
ALA 413 498 375 525 *
PRO 193 461 * 368 278
GABA 443 818 * 406 848 **
VAL 338 463 * 394 401
LYS 440 532 448 518
LEU 61 90 * 68 81
PHE 253 215 268 205
Total AA 9257 11126 * 10447 9880
a *,** indicates a significant difference at P <0.05 and 0.01 level,
respectively, between means of individual carbohydrates and amino
acids for the individual treatments of water cycle or Trichoderma.
Seedlings on plates
Tc
HK
Tc
MA
PK
3
Tc
MK
K4
Tc
PP
2C
Tc
SO
T
%
o
f A
C
TI
N
0
5
10
15
20
25
30
Control
219b
Seedlings on plates
Tc
AB
C-
T
Tc
RP
K
Tc
ST
K
Tc
TP
P
Tc
NR
%
o
f A
C
TI
N
0
1
2
3
4
5
6
Control
219b
A
B
Fig. 7. Direct influence of DIS 219b colonization on gene
expression in 9-d-old cacao seedlings germinated on 1.5% water
agar plates. Colonized (219b) or non-colonized (Control) seedlings
were grown for 9 d as described in the text. The whole seedling
minus the cotyledons was harvested for qPCR analysis. A subset
of drought-responsive ESTs was analysed. The relative mRNA
levels of the ESTs were calculated with respect to ACTIN
transcripts (% of ACTIN). Bars show means 6standard error
(n¼4).
3288 | Bae et al.
Nineteen drought-responsive ESTs were newly identified in
cacao. These ESTs were chosen based on their relatedness
to orthologues in other plants with characterized involve-
ment in various biological processes, including drought
(Table 1). The majority of the drought-responsive ESTs (16
out of 19) were identified in previous studies characterizing
the responses of cacao to other biotic and abiotic stresses
(Verica et al., 2004; Bailey et al., 2006).
ESTs putatively involved in the production of osmopro-
tectants and/or regulatory metabolites were responsive to
drought (Fig. 4). In a previous study, it was found that
three ESTs (TcODC, TcADC, and TcSAMDC) putatively
involved in polyamine biosynthesis are also responsive to
drought in cacao (Bae et al., 2008). Osmolytes are sugars,
sugar alcohols, amino acids, and amines. Osmolytes accu-
mulate under drought stress in order to maintain cell turgor
and to stabilize cell proteins and structures (reviewed by
Valliyodan and Nguyen, 2006; Seki et al., 2007). TcTPP
putatively encodes the enzyme trehalose-6-phosphatase, the
enzyme that catalyses the final step in trehalose biosynthe-
sis. Trehalose confers drought tolerance to microorganisms,
various higher plants, and to transformants engineered to
Table 4. Changes in biomass and water content in cacao
seedlings due to varying watering cycle (1, 3, 7, and 10 d) and
Trichoderma hamatum isolate DIS 219b treatment (colonized or
non-colonized)
Treatments were DIS 219b-colonized (219b) or non-colonized seed-
lings (Control) watered every 1, 3, 7, or 10 d. The seedlings were
grown at 25 C and an average of 80% humidity. The watering cycle
was initiated after 32 d and continued for 21 d. Statistical analysis
was carried out as described in the text. The interaction between
water cycle and Trichoderma was not significant, so means are
presented for water cycle effect over both Trichoderma treatments
and for the Trichoderma effect over all water cycle treatments.
Measurement P-value Treatment Weight (g) Means
separationa
Water cycle effect
Root fresh wt 0.0006 1 d 1.91 A
3 d 2.07 A
7 d 1.95 A
10 d 1.61 B
Root dry wt 0.0007 1 d 0.35 B
3 d 0.40 AB
7 d 0.44 A
10 d 0.38 AB
Root water wt <0.0001 1 d 1.56 A
3 d 1.67 A
7 d 1.51 A
10 d 1.22 B
Trichoderma effect
Root fresh wt <0.0001 Control 1.74 B
219b 2.06 A
Root dry wt <0.0001 Control 0.36 B
219b 0.43 A
Root water wt <0.0001 Control 1.38 B
219b 1.63 A
a Treatment means for measurements within the factors water cycle
and Trichoderma followed by the same letter are not significantly
different at the P <0.05 level.
Table 5. Changes in biomass and water content in cacao
seedlings due to varying watering cycle (3 or 5 days) and
Trichoderma hamatum isolate DIS 219b treatment (colonized or
non-colonized)
Treatments were DIS 219b colonized (219b) or non-colonized
seedlings (Cont) watered every 3 or 5 days. The seedlings were
grown at 25C and 40% to 45% humidity. The watering cycles were
initiated after 32 days and continued for 15 days. Statistical analysis
was carried out as described in the text. Means for the interaction
between water cycle and Trichoderma are presented only where
significant. Otherwise means are presented for water cycle effect
over both Trichoderma treatments and for the Trichoderma effect
over both water cycle treatments.
Measurement P-value Treatment Weight (g) Means
separationa
Water cycle effect
Root Fresh 0.0005 3 day 2.471 A
Weight 5 day 2.186 B
Root Dry 0.0035 3 day 0.516 A
Weight 5 day 0.464 B
Total 0.0012 3 day 6.131 A
Fresh Weight 5 day 5.217 B
Root Water 0.0003 3 day 1.954 A
Weight 5 day 1.722 B
Total Water 0.0001 3 day 4.557 A
Weight 5 day 3.864 B
Root Dry Wt/ 0.0382 3 day 0.493 B
Top Dry Wt 5 day 0.526 A
Trichoderma effect
Root Fresh 0.0001 Cont 2.192 B
Weight 219b 2.492 A
Root Dry 0.0006 Cont 0.464 B
Weight 219b 0.521 A
Total Fresh 0.0012 Cont 5.507 B
Weight 219b 5.951 A
Root Water <0.0001 Cont 1.729 B
Weight 219b 1.970 A
Total Water 0.0012 Cont 4.086 B
Weight 219b 4.420 A
Root Dry Wt/ 0.0459 Cont 0.49 B
Top Dry Wt 219b 0.523 A
Water cycle by Trichoderma Interactions
Top Fresh 0.0436 Cont/3 day 3.481 B
Weight 219b/3 day 3.844 A
Cont/5 day 3.054 C
219b/5 day 3.011 C
Top Dry 0.0090 Cont/3 day 0.991 B
Weight 219b/3 day 1.126 A
Cont/5 day 0.904 C
219b/5 day 0.876 C
Total Dry 0.0094 Cont/3 day 1.463 B
Weight 219b/3 day 1.687 A
Cont/5 day 1.354 C
219b/5 day 1.350 C
a Treatment means for measurements within the factors water cycle
and Trichoderma and the water cycle by Trichoderma interaction
followed by the same letter are not significantly different at the
P <0.05 level.
Trichoderma delays the onset of the drought response in cacao | 3289
2002). In cacao, TcTPP induction was an early response to
drought in roots (7 d) but a late response in leaves (13 d).
TcSOT, a putative sorbitol transporter, was induced 7
d PW in roots and 10 d PW in leaves. Sorbitol is the major
phloem-translocated carbohydrate in some plant species
and, similar to trehalose, is thought to be important in
stress tolerance (Watari et al., 2004). TcPR5 was induced by
drought 10 d PW in leaves and roots and encodes an
osmotin-like protein. Osmotins and osmotin-like protein,
members of the PR-5 protein family, are commonly
associated with tolerance to osmotic stress and in plant
defence (D’Angeli and Altamura, 2007). TcNI was induced
by drought in leaves only. TcNI has close similarity to genes
encoding alkaline/neutral invertases. Alkaline/neutral inver-
tases participate in the hydrolysis of sucrose, providing
a source of carbon for the biosynthesis of other osmopro-
tective substances and/or as a source of energy (Sturm,
1999). Lastly, TcCESA3, putatively encoding a cellulose
synthase, was repressed in the roots by drought. Foyer et al.
(1998) suggested that drought stress can increase sugar
accumulation through inhibition of cellulose synthesis.
While TcLOX and TcAOC were chosen for their poten-
tial involvement in jasmonic acid biosynthesis, they do not
show coordinated regulation in response to drought.
TcLOX is induced by drought only in roots starting at 10 d
PW (Fig. 5), putatively encoding a 13-lipoxygenase involved
in jasmonic acid biosynthesis through a pathway that
includes allene oxide cyclase (AOC). TcAOC putatively
encodes an AOC, a plastid-associated protein (Hause et al.,
2003). TcAOC was repressed by drought only in roots
starting 10 d PW (Fig. 5). In Arabidopsis, four AOCs were
localized to the chloroplast (Stenzel et al., 2003). Hause
et al. (2003) verified that AOC in tomato is also associated
with companion cells and plastids within sieve elements of
vascular bundles, allowing for its possible function in cacao
roots responding to drought.
The movement of molecules across membranes is critical
for maintaining normal cell function. Aquaporins or major
intrinsic proteins are responsible for the transcellular
movement of water across the cell membranes (Steudle,
1994). In this study, TcTIP (P31), putatively encoding
a tonoplast intrinsic protein, was repressed in the roots by
drought at 7 d PW (Fig. 5). In an earlier study involving
9-d-old seedlings, colonization by DIS 219b also strongly
repressed TcTIP (P31) expression (Bailey et al., 2006). The
repression of aquaporin gene expression may result in
reduced membrane water permeability and encourage water
conservation during periods of drought (Luu and Maurel,
2005; Secchi et al., 2007). Expression of TcABC-T was also
repressed in roots by drought beginning at 7 d PW. ABC
transporters function in the movement of molecules across
membranes in an ATP-dependent process (Jasinski et al.,
3 days
5 days
0
10
20
30
40
50
60
Control
219b
Weight class (g)
>0
.55
0.5
5->
0.5
0
0.5
0->
0.4
5
0.4
5->
0.4
0
0.4
0->
0.3
5
0.3
5 o
r le
ss
De
ad
Se
ed
lin
gs
in
ro
ot
w
ei
gh
t c
la
ss
(%
)
0
10
20
30
40
50
Fig. 8. The influence of DIS 219b colonization and watering cycle
on the dry weight of cacao roots. For each treatment combination
in the second biomass study, seedlings were grouped into 0.05 g
weight class increments based on their root dry weights. The
percentage of seedlings that died during the experiment is
also included for each treatment combination. Bars show
means6standard error.
Table 6. Changes in leaf angle in cacao seedlings due to varying
watering cycle (3 d or 5 d) and Trichoderma hamatum isolate DIS
219b treatment (colonized or non-colonized)
Leaf angle was determined as the drop of the leaf blade tip from
horizontal using a protractor. Treatments were DIS 219b-colonized
(219b) or non-colonized seedlings (Control) watered every 3 d or 5 d.
The seedlings were grown at 25 C and 40–45% humidity. The
watering cycles were initiated after 32 d and continued for 15 d.
Leaf angle was measured three times at the end of each 5 d water
cycle. Statistical analysis was carried out as described in the text.
Means for the interaction between water cycle and Trichoderma
are presented.
Measurement P value Treatment Angle () Means
separationa
Leaf angle cycle 1 0.2227 Control/3 d 36.61 A
219b/3 d 34.06 A
Control/5 d 62.79 B
219b/5 d 52.79 B
Leaf angle cycle 2 0.0158 Control/3 d 30.00 A
219b/3 d 29.29 A
Control/5 d 51.55 B
219b/5 d 36.94 A
Leaf angle cycle 3 0.0097 Control/3 d 30.69 A
219b/3 d 29.57 A
Control/5 d 59.13 C
219b/5 d 41.17 B
a Treatment means for measurements followed by the same letter
are not significantly different at the P <0.05 level.
3290 | Bae et al.
ESTs (TcTIP, TcABC-T, and TcSOT) allude to the
significant impact of drought on the movement of molecules
across membranes in cacao.
Orthologues of TcSEN1 are found in many plant species
and are induced by darkness and during senescence
(Shimada et al., 1998). Their function is unknown, but
a recent study by Yang et al. (2003) suggested that the
tobacco orthologue, Ntdin, plays a role in N- and S-
metabolism functioning in molybdenum cofactor biosynthe-
sis. Nitrate reductase (NR) is the first enzyme of primary N
assimilation in plants (Ferrario-Mery et al., 1998). As was
observed in cacao roots for TcNR (Fig. 5), NR enzyme
activity and transcript abundance are known to be sensitive
to repression by drought (Ferrario-Mery et al., 1998).
During drought stress, increases in plant cell osmolarity
trigger signal transduction, resulting in activation of
components of the drought response (reviewed by Beck
et al., 2007). In cacao roots, starting at 7 d PW, TcRPK
(putative receptor-like protein kinase), TcMKK4 [putative
mitogen-activated protein (MAPK) possibly involved in
the plant defence response], and TcSTK (putative serine/
threonine protein kinase) were down-regulated in response
to drought and TcHK (putative sensor type histidine
kinase, possible osmoticum/cytokinin receptor), and
TcPP2C (putative protein phosphatase 2C) were up-
regulated in response to drought (Fig. 6). Histidine kinases
are membrane-associated proteins that bind ligands serving
as sensory preceptors, transmitting signals that participate
in multiple gene regulatory cascades. HK can activate
MAPK pathways (Zhu, 2002). TcMAPK3, a putative
mitogen-activated protein kinase, was induced by drought
but not until 10 d PW in both leaves and roots. TcMAPK3
has close similarity to a family of MAP kinases that are
inducible by various effectors including wounding, drought,
cold, and salt, in addition to several plant hormones
(Morris, 2001). Of particular interest is WIPK which is
a transducer of the wounding signal leading to the synthesis
of jasmonic acid (Morris, 2001) and TIPK of Cucumis
sativus which is required for Trichoderma-conferred plant
resistance (Shoresh et al., 2006). TcPP2C was induced in
cacao roots 7 d PW. PP2Cs are ubiquitous protein
phosphatases found in all eukaryotes and several PP2Cs
are involved in ABA responses (Tahtiharju and Palva,
2001; Saez et al., 2004). Kinase-associated protein phos-
phatases serve as negative regulators for receptor-like
kinases (Williams et al., 1997; Li et al., 1999). For example,
in alfalfa (Medicago sativa), MAPKs were regulated by
protein phosphatase 2C (MP2C) by dephosphorylation
(Meskiene et al., 2003). TcZFP (P13), a putative C2H2 zinc
finger protein, was induced by drought, but not until 10
d PW in roots and 13 d PW in leaves. TcZFP (P13) was
originally isolated by differential display and was shown to
be induced by Trichoderma colonization in 9-d-old cacao
seedlings (Bailey et al., 2006). C2H2 zinc finger proteins
may function as key transcriptional repressors involved in
the responses of plants to stresses (Ciftci-Yilmaza and
Mittler, 2008).
DIS 219b colonization delays drought-induced changes
in gene expression
The drought-induced changes in gene expression patterns
were delayed in leaves of colonized seedlings, whereas many
of the drought-induced changes in gene expression observed
in roots were not. For example, in leaves, the drought-
altered expression of TcrbcS (Fig. 3), TcTPP (Fig. 4), and
TcMAPK3 (Fig. 6) was delayed in colonized seedlings.
Examples where the delay did not occur in roots include
TcAOC, TcLOX, TcSEN1, TcNR, TcTPP, TcTIP, TcABC-
T, TcHK, TcRPK, and TcMKK4 (Figs 4–6). DIS 219b
caused a significant lag in the initiation of the drought
response in the leaf but less so in the root.
Although consistent changes in cacao gene expression in
watered seedlings over time in response to colonization were
not observed, differences in gene expression due to coloni-
zation at specific time points were observed. These differ-
ences, for example for TcNR (Fig. 5), TcABC-T (Fig. 5),
and TcHK and TcZFP (Fig. 6) at time zero, tended to be no
more than 2-fold.
Changes in carbohydrate and amino acids in cacao
during drought stress
Glucose content of cacao leaves increased during drought
stress despite the reduction in carbon fixation due to both
stomatal closure and down-regulation of the Calvin cycle.
Foliar levels of starch and sucrose were not changed by
drought or DIS 219b colonization. During drought stress,
soluble carbohydrates (glucose, fructose, sucrose, stachyose,
mannitol, and pinitol) can accumulate in leaves in a response
that varies among plant species (reviewed by Valliyodan
and Nguyen, 2006). Soluble carbohydrates serve as protec-
tants, nutrients, and metabolite signalling molecules that
modulate the transcription of genes involved in sugar
sensing mechanisms (Ho et al., 2001; Price et al., 2004; Li
et al., 2006).
Concentrations of seven soluble amino acids were altered
by withholding water for 13 d (Table 2). Concentrations of
four soluble amino acids were altered by DIS 219b
colonization. Pro concentrations increased in response to
drought stress. A positive relationship between Pro accu-
mulation and drought tolerance has been reported in many
plant species (Bandurska, 2000; Nayyar and Walia, 2003;
Chandra et al., 2004; Simon-Sarkadi et al., 2006). The
influence of VAM and the grass endophytes on the drought-
induced accumulation of Pro and other amino acids varies
depending on the endophyte/plant interaction, the tissue
sampled, the nutritional status of the plants, and many
other factors (Malinowski and Belesky, 2000; Auge´, 2001).
Glu and Arg can function as Pro precursors. The trend was
for a decrease in Glu concentration in non-watered seed-
lings, while Arg concentrations increased significantly in
non-watered non-colonized seedlings. This result might
indicate that Pro is synthesized mainly using Glu in cacao
seedlings instead of Arg during drought treatment. In
a previous study, the induction of polyamines in cacao was
Trichoderma delays the onset of the drought response in cacao | 3291
Glu might also be used for the synthesis of polyamine in
cacao during drought stress. The accumulation of Arg in
response to water deprivation was also observed in wheat
(Galiba et al., 1989) and Brassica napus (Good and
Zaplachinski, 1994).
GABA concentrations in cacao leaves increased in re-
sponse to drought and DIS 219b colonization (Table 3).
Glu concentration decreased in DIS 219b-colonized seed-
lings. Glu and GLN usually are the principal amino acids
present in foliar tissue. Ala concentrations also increased in
response to DIS 219b colonization. The Ala response may
be a by-product of the GABA shunt, as a result of the
activity of GABA transaminase using pyruvate as the
amino group acceptor (Shelp et al., 1999). GABA is
produced in response to various abiotic stresses including
water stress (Bouche´ et al., 2003; Oliver and Solomon, 2004;
Fait et al., 2005; Mazzucotelli et al., 2006).
Initial DIS 219b colonization alters expression of
drought-responsive genes
Under non-drought conditions, colonization by DIS 219b
altered expression of several drought-responsive ESTs in 9-
d-old seedlings (Fig. 7). It was in these same 9-d-old
seedlings that induction by Trichoderma colonization of
TcODC, a putative ornithine decarboxylase that is drought-
responsive (Bae et al., 2008), and TcZFP (P13), a putative
C2H2 zinc finger protein, was noted earlier (Bailey et al.,
2006). It is of particular interest and a subject for further
research that a dramatic increase in expression of TcNR
(putative nitrate reductase) was observed in 9-d-old colo-
nized seedlings (Fig. 7). This is in contrast to the effect of
drought which typically causes a decrease in expression of
the nitrate reductase genes (Ferrario-Mery et al., 1998),
a response also observed in cacao roots after drought
exposure (Fig. 5). The endophytic fungus Piriformospora
indica promoted growth of Arabidopsis and tobacco seed-
lings and stimulated nitrogen accumulation and the expres-
sion of a gene encoding NR in roots (Sherameti et al.,
2005). It was noted by Sherameti et al. (2005) that
recruitment of nitrogen in endophytic interactions differs
from mycorrhizal interactions in which the fungus preferen-
tially recruits ammonium rather than nitrate, and the plant
NR enzyme is down-regulated. By comparing the patterns
of altered gene expression in 9-d-old seedlings colonized by
DIS 219b with seedling responding to drought (32–45 d old)
it is clear that, although the two treatments sometimes alter
expression of the same ESTs, the direction of that influence
is sometimes in opposite directions.
Plant growth promotion by Trichoderma hamatum
isolate DIS 219b
In the initial biomass study, colonization of cacao seedlings
by DIS 219b enhanced growth, resulting in an increase in
root fresh and dry weight, and root water weight in-
dependent of the water cycle (Table 4). In a second biomass
study, DIS 219b again enhanced growth independent of the
water cycle, resulting in an increase in root fresh weight,
root dry weight, total fresh weight, root water weight, total
water weight, and the root dry weight/root fresh weight
ratio (Table 5). In the second biomass study a delay in the
drooping of cacao leaves in response to drought (Table 6)
was associated with the DIS 219b colonization. In the
second biomass study humidity was maintained at 40%,
resulting in much drier conditions and a shorter time period
until wilting than observed in the earlier studies. The ability
of Trichoderma isolates to enhance plant growth has been
characterized in other cropping systems, although the
mechanisms involved have not been fully explained (Harman
et al., 2004). Plant growth promotion is often observed
in response to Trichoderma colonization (Harman et al.,
2004; Lynch, 2004; Adams et al., 2007). Enhanced nutrient
availability through solubilization and chelation of minerals
and increased nutrient uptake efficiency, among others, are
proposed mechanisms involved in Trichoderma-induced
plant growth promotion (Altomare et al., 1999; Yedidia
et al., 2001; Harman et al., 2004). The impact of endophyte-
induced enhanced plant growth on drought tolerance has
been extensively studied for VAM/plant associations and
endophytes of cool-season grasses (Malinowski and
Belesky, 2000; Auge´, 2001). The abilities of larger plant
tissues to store water as observed here are commonly cited
mechanisms for enhancing drought tolerance in plants
(Malinowski and Belesky, 2000; Auge´, 2001).
Conclusions
Although net photosynthesis and stomatal conductance in
cacao leaves were significantly altered in response to
drought 7 d PW, leaf gene expression tended to remain
unaltered until 10 d PW. By contrast, many of the ESTs
studied that responded to drought in roots did so starting at
7 d PW, demonstrating the early perception of drought and
rapid alteration of gene expression in roots. Much of the
drought-altered expression of ESTs in roots was not
influenced by DIS 219b colonization, whereas the ESTs
responding to drought in leaves demonstrated a delayed
drought response when the seedlings were colonized by DIS
219b. Most of the physiological measurements evaluated
(leaf responses) showed a similar delay in response to
drought when seedlings are colonized by DIS 219b. This
leads to the suggestion that the delay in the cacao drought
response observed in colonized seedlings is due to changes
in the physiology of the seedling and not due to changes in
the seedling’s interaction with the soil at the time of drought
exposure. The simplest explanation is that DIS 219b
colonization enhanced root growth, resulting in improved
water acquisition and an increase in water content. The
roots of colonized seedlings perceive the dry soils and
respond while the leaves take advantage of the increased
water availability through the roots, resulting in a delayed
drought response. Unfortunately, when plant growth pro-
motion occurs, it can be very difficult to separate out the
3292 | Bae et al.
status. The changes in plant growth may themselves be
mediated through direct effects of DIS 219b colonization on
cacao gene expression observed during the early stages of
seedling colonization. The concentrations of several amino
acids, notably GABA, were also directly responsive to DIS
219b colonization, leaving open the possibility that coloniza-
tion may pre-adapt cacao to drought as a component of the
altered signal transduction pathways observed in direct
response to colonization. The colonization of cacao seedlings
by T. hamatum isolate DIS 219b enhanced seedling growth,
altered gene expression, and delayed the onset of the cacao
drought response in leaves at the molecular, physiological,
and phenotypic levels, a response that could prove valuable
in the production of this important tropical crop.
Acknowledgement
This work was partially supported by the grant from the
BioGreen 21 program of Rural Development and Adminis-
tration, Republic of Korea.
References
Adams P, De-Leij FAAM, Lynch JM. 2007. Trichoderma harzianum
Rifai 1295-22 mediates growth promotion of crack willow (Salix fragilis)
saplings in both clean and metal-contaminated soil. Microbial Ecology
54, 306–313.
Altomare C, Norvell WA, Bjorkman T, Harman GE. 1999.
Solubilization of phosphates and micronutrients by the plant-growth-
promoting and biocontrol fungus Trichoderma harzianum Rifai. 1295–
22. Applied and Environmental Microbiology 65, 2926–2933.
Arnold AE, Mejı´a LC, Kyllo D, Rojas EI, Maynard Z, Robbins N,
Herre EA. 2003. Fungal endophytes limit pathogen damage in
a tropical tree. Proceedings of the National Academy of Sciences,
USA 100, 15649–15654.
Auge´ RM. 2001. Water relations, drought and VA mycorrhizal
symbiosis. Mycorrhiza 11, 3–42.
Bae H, Kim S-H, Kim MS, Sicher RC, Strem MD, Natarajan S,
Bailey BA. 2008. The drought response of Theobroma cacao (cacao)
and the regulation of genes involved in polyamine biosynthesis by
drought and other stresses. Plant Physiology and Biochemistry 46,
174–188.
Bailey BA, Bae H, Strem MD, Roberts DP, Thomas SE,
Samuels GJ, Choi I-Y, Holmes KA. 2006. Fungal and plant gene
expression during the colonization of cacao seedlings by endophytic
isolates of four Trichoderma species. Planta 224, 1449–1464.
Bailey BA, Bae H, Strem MD, Crozier J, Thomas SE,
Samuels GJ, Vinyard BT, Holmes KA. 2008. Antibiosis, mycopar-
asitism, and colonization success for endophytic Trichoderma isolates
with biological control potential in Theobroma cacao. Biological
Control 46, 24–35.
Bailey BA, Strem MD, Antu´nez de Mayolo G, Guiltinan MJ. 2005.
Gene expression in leaves of Theobroma cacao in response to
mechanical wounding, ethylene, or methyl jasmonate. Plant Science
128, 1247–1258.
Bandurska H. 2000. Does proline accumulated in leaves of water
stressed barley plants confine cell membrane injury? I. Free proline
accumulation and membrane injury index in drought and osmotically
stressed plants. Acta Physiologiae Plantarum 22, 409–415.
Bastos CN. 1996. Potential de Trichoderma viride no controle da
vassoura-de-bruxa (Crinipellis perniciosa) do cacaueiro. Fitopatologia
Brazileira 21, 509–512.
Beck EH, Fettig S, Knake C, Hartig K, Bhattarai T. 2007. Specific
and unspecific responses of plants to cold and drought stress. Journal
of Biosciences 32, 501–510.
Belsky JM, Siebert SF. 2003. Cultivating cacao: implications of sun-
grown cacao on local food security and environmental sustainability.
Agriculture and Human Values 20, 277–285.
Bouche´ N, Fait A, Bouchez D, Moller SG, Fromm H. 2003.
Mitochondrial succinic semialdehyde dehydrogenase of the
c-aminobutyrate shunt is required to restrict levels of reactive oxygen
intermediates in plants. Proceedings of the National Academy of
Sciences, USA 100, 6843–6848.
Buschmann C, Langsdorf G, Lichtenthaler HK. 2000. Imaging of
the blue, green and red fluorescence emission of plants: an overview.
Photosynthetica 38, 483–491.
Chandra A, Pathak PS, Bhatt RK, Dubey A. 2004. Variation in
drought tolerance of different Stylosanthes accessions. Biologia
Plantarum 48, 457–460.
Ciftci-Yilmaza S, Mittler R. 2008. The zinc finger network of plants.
Cellular and Molecular Life Sciences 65, 1150–1160.
D’Angeli S, Altamura MM. 2007. Osmotin induces cold protection in
olive trees by affecting programmed cell death and cytoskeleton
organization. Planta 225, 1147–1163.
Davies FT, Svenson SE, Henderson JC, Phavaphutanon L,
Duray SA, Olalde-Portugal V, Meier CE, Bo SH. 1996. Non-
nutritional stress acclimation of mycorrhizal woody plants exposed to
drought. Tree Physiology 16, 985–993.
Evans HC, Holmes KA, Thomas SE. 2003. Endophytes and
mycoparasites associated with an indigenous forest tree, Theobroma
gileri, in Ecuador and a preliminary assessment of their potential as
biocontrol agents of cocoa diseases. Mycological Progress 2, 149–160.
Fait A, Yellin A, Fromm H. 2005. GABA shunt deficiencies and
accumulation of reactive oxygen intermediates: insight from
Arabidopsis mutants. FEBS Letters 579, 415–420.
Ferrario-Mery S, Valadier M-H, Foyer CH. 1998. Overexpression of
nitrate reductase in tobacco delays drought-induced decreases in
nitrate reductase activity and mRNA. Plant Physiology 117, 293–302.
Foyer CH, Valadier MH, Migge A, Becker TW. 1998. Drought-
induced effects on nitrate reductase activity and mRNA and on the
coordination of nitrogen and carbon metabolism in maize leaves. Plant
Physiology 117, 283–292.
Galiba G, Simon-Sarkadi L, Salgo´ A, Kocsy G. 1989. Genotype
dependent adaptation of wheat varieties to water stress in vitro.
Journal of Plant Physiology 134, 730–735.
Garg AK, Kim J-K, Owens TG, Ranwala AP, Choi YD,
Kochian LV, Wu RJ. 2002. Trehalose accumulation in rice plants
Trichoderma delays the onset of the drought response in cacao | 3293
of the National Academy of Sciences, USA 99, 15898–15903.
Good AG, Zaplachinski ST. 1994. The effects of drought stress on
free amino acid accumulation and protein synthesis in Brassica napus.
Physiologia Plantarum 90, 9–14.
Harman GE, Howell CR, Viterbo A, Chet I. 2004. Trichoderma spp.:
opportunistic avirulent plant symbionts. Nature Reviews 2, 43–56.
Hause B, Hause G, Kutter C, Miersch O, Wasternack C. 2003.
Enzymes of jasmonate biosynthesis occur in tomato sieve elements.
Plant Cell and Physiology 44, 643–648.
Hideg E´, Juha´sz M, Bornman JF, Asada K. 2002. The distribution
and possible origin of blue–green fluorescence in control and stressed
barley leaves. Photochemical & Photobiological Sciences 1, 934–941.
Ho S-L, Chao Y-C, Tong W-F, Yu S-M. 2001. Sugar coordinately
and differentially regulates growth- and stress-related gene expression
via a complex signal transduction network and multiple control
mechanisms. Plant Physiology 125, 877–890.
Holmes KA, Krauss U, Samuels GJ. 2006. Trichoderma
ovalisporum, a novel biocontrol agent of frosty pod rot (Moniliophthora
roreri) of cocoa (Theobroma cacao): from discovery to field. In: Sorvari
S, Toldi O, eds. Proceedings of the 1st International Conference on
Plant Microbe Interactions: Endophytes and Biocontrol Agents, 18–22
April 2005. Saariselka, Lapland,Finland, 54–65.
Holmes KA, Schroers H-J, Thomas SE, Evans HC, Samuels GJ.
2004. Taxonomy and biocontrol potential of a new species of
Trichoderma from the Amazon basin in South America. Mycological
Progress 3, 199–210.
Jasinski M, Ducos E, Martinoia E, Boutry M. 2003. The ATP-
binding cassette transporters: structure, function and gene family
comparison between rice and Arabidopsis. Plant Physiology 131,
1169–1177.
Kim MS, Lefcourt AM, Chen YR. 2003. Multispectral laser-induced
fluorescence imaging system for large biological samples. Applied
Optics 42, 3927–3934.
Li J, Smith GP, Walker JC. 1999. Kinase interaction domain of
kinase-associated protein phosphatase, a phosphoprotein-binding
domain. Proceedings of the National Academy of Sciences, USA 96,
7821–7826.
Li Y, Lee KK, Walsh S, Smith C, Hadingham S, Sorefan K,
Cawley G, Bevan MW. 2006. Establishing glucose- and ABA-
regulated transcription networks in Arabidopsis by microarray analysis
and promoter classification using a Relevance Vector Machine.
Genome Research 16, 414–427.
Lichtenthaler HK, Miehe´ JA. 1997. Fluorescence imaging as
a diagnostic tool for plant stress. Trends in Plant Science 2, 316–320.
Luu DT, Maurel C. 2005. Aquaporins in a challenging environment:
molecular gears for adjusting plant water status. Plant, Cell &
Environment 28, 85–96.
Lynch JM. 2004. Plant growth promoting agents. In: Bull AT, ed.
Microbial diversity and bioprospecting. Washington, DC: American
Society for Microbiology, 391–396.
Malinowski DP, Belesky DP. 2000. Adaptation of endophyte-
infected cool-season grasses to environmental stresses: mechanisms
of drought and mineral stress tolerance. Crop Science 40, 923–940.
Mazzucotelli E, Tartari A, Cattivelli L, Forlani G. 2006. Metabolism
of c-amnobutyric acid during cold acclimation and freezing and its
relationship to frost tolerance in barley and wheat. Journal of
Experimental Botany 57, 3755–3766.
Meskiene I, Baudouin E, Schweighofer A, Liwosz A, Jonak C,
Rodriguez PL, Jelinek H, Hirt H. 2003. The stress-induced protein
phosphatase 2C is a negative regulator of a mitogen-activated protein
kinase. Journal of Biological Chemistry 278, 18945–18952.
Mohd Razi I, Abd Halim H, Kamariah D, Mohd Noh J. 1992.
Growth, plant water relation and photosynthesis rate of young
Theobroma cacao as influenced by water stress. Pertanika 15, 93–97.
Morris PC. 2001. MAP kinase signal transduction pathways in plants.
New Phytologist 151, 67–89.
Nayyar H, Walia DP. 2003. Water stress-induced Pro accumulation
in contrasting wheat genotypes as affected by calcium and abscisic
acid. Biologia Plantarum 46, 275–279.
Oliver RP, Solomon PS. 2004. Does the oxidative stress used by
plants for defence provide a source of nutrients for pathogenic fungi?
Trends in Plant Science 9, 472–473.
Passioura JB. 1996. Drought and drought tolerance. Plant Growth
Regulation 20, 79–83.
Pfaffl MW. 2001. A new mathematical model for relative quantification
in real-time RT-PCR. Nucleic Acids Research 29, 2003–2007.
Price J, Laxmi A St, Martin SK, Jang J-C. 2004. Global
transcription profiling reveals multiple sugar signal transduction mech-
anisms in Arabidopsis. The Plant Cell 16, 2128–2150.
Rubini MR, Silva-Ribeiro RT, Pomella AWV, Maki CS,
Araujo WL, dos Santos DR, Azevedo JL. 2005. Diversity of
endophytic fungal community of cacao (Theobroma cacao L.) and
biological control of Crinipellis perniciosa, causal agent of witches’
broom disease. International Journal of Biological Sciences 1, 24–33.
Saez A, Apostolova N, Gonzalez-Guzman M, Gonzalez-
Garcia MP, Nicolas C, Lorenzo O, Rodriguez PL. 2004. Gain-of-
function and loss-of-function phenotypes of the protein phosphatase
2C HAB1 reveal its role as a negative regulator of abscisic acid
signalling. The Plant Journal 37, 354–369.
Secchi F, Lovisolo C, Uehlein N, Kaldenhoff R, Schubert A.
2007. Isolation and functional characterization of three aquaporins
from olive (Olea europea L). Planta 225, 381–392.
Seki M, Umezawa T, Urano K, Shinozaki K. 2007. Regulatory
metabolic networks in drought stress responses. Current Opinion in
Plant Biology 10, 296–302.
Shelp BJ, Bown AW, McLean MD. 1999. Metabolism and function
of gamma-aminobutyric acid. Trends in Plant Science 4, 446–452.
Sherameti I, Shahollari B, Venus Y, Altschmied L, Varma A,
Oelmuller R. 2005. The endophytic fungus Piriformospora indica
stimulates the expression of nitrate reductase and the starch-
degrading enzyme glucan-water dikinase in tobacco and Arabidopsis
roots through a homeodomain transcription factor that binds to
a conserved motif in their promoters. Journal of Biological Chemistry
280, 26241–26247.
Shimada Y, Wu GJ, Watanabe A. 1998. A protein encoded by din1,
a dark-inducible and senescence-associated gene of radish, can be
imported by isolated chloroplasts and has sequence similarity to
3294 | Bae et al.
Physiology 39, 139–143.
Shoresh M, Gal-On A, Leibman D, Chet I. 2006. Characterization
of a mitogen-activated protein kinase gene from cucumber required
for Trichoderma-conferred plant resistance. Plant Physiology 142,
1169–1179.
Sicher RC. 2001. Responses of nitrogen metabolism in N-sufficient
barley primary leaves to plant growth in elevated atmospheric carbon
dioxide. Photosynthesis Research 68, 193–201.
Simon-Sarkadi L, Kocsy G, Varhegyi A´, Galiba G, De Ronde JA.
2006. Stress-induced changes in the free amino acid composition in
transgenic soybean plants having increased proline content. Biologia
Plantarum 50, 793–796.
Stenzel I, Hause B, Miersch O, Kurz T, Maucher H, Weichert H,
Ziegler J, Feussner I, Wasternack C. 2003. Jasmonate biosynthe-
sis and the allene oxide cyclase family of Arabidopsis thaliana. Plant
Molecular Biology 51, 895–911.
Steudle E. 1994. Water transport across roots. Plant Soil 167, 79–90.
Sturm A. 1999. Invertases: primary structures, functions, and roles in
plant development, and sucrose partitioning. Plant Physiology 121, 1–7.
Tahtiharju S, Palva T. 2001. Antisense inhibition of protein phospha-
tase 2C accelerates cold acclimation in Arabidopsis thaliana. The Plant
Journal 26, 461–470.
Valliyodan B, Nguyen HT. 2006. Understanding regulatory networks
and engineering for enhanced drought tolerance in plants. Current
Opinion in Plant Biology 9, 1–7.
Verica J, Maximova S, Strem M, Carlson J, Bailey B,
Guiltinan M. 2004. Isolation of early defense-related ESTs from
subtracted normalized cDNA libraries of elicited cacao (Theobroma
cacao L.) leaves. Plant Cell Reports 23, 404–413.
Watari J, Kobae Y, Yamaki S, Yamada K, Toyofuku K,
Tabuchi T, Shiratake K. 2004. Identification of sorbitol transporters
expressed in the phloem of apple source leaves. Plant Cell and
Physiology 45, 1032–1041.
Williams RW, Wilson JM, Meyerowitz EM. 1997. A possible role for
kinase-associated protein phosphatase in the Arabidopsis CLAVATA1
signaling pathway. Proceedings of the National Academy of Sciences,
USA 94, 10467–10472.
Wilson M. 1997. Biocontrol of aerial plant diseases in agriculture and
horticulture: current approaches and future prospects. Journal of
Industrial Microbiology & Biotechnology 19, 188–191.
Wood GAR, Lass RA. 2001. Cacao, 4th edn. Oxford: Blackwell
Science.
Yang SH, Berberich T, Miyazaki A, Sano H, Kusano T. 2003.
NtDin, a tobacco senescence-associated gene, is involved in molyb-
denum cofactor biosynthesis. Plant Cell and Physiology 44,
1037–1044.
Yedidia I, Srivastva AK, Kapulnik Y, Chet I. 2001. Effect of
Trichoderma harzianum on microelement concentrations and in-
creased growth of cucumber plants. Plant Soil 235, 235–242.
Zhu J-K. 2002. Salt and drought stress signal transduction in plants.
Annual Review of Plant Biology 53, 247–273.
Trichoderma delays the onset of the drought response in cacao | 3295
Sign up today - FREE
Mendeley saves you time finding and organizing research. Learn more
- All your research in one place
- Add and import papers easily
- Access it anywhere, anytime



