Sign up & Download
Sign in

Transcription profiling of eleven cytochrome P450s potentially involved in xenobiotic metabolism in the mosquito Aedes aegypti.

by R Poupardin, M A Riaz, J Vontas, J P David, S Reynaud
Insect Molecular Biology (2010)

Abstract

Transcription profiles of 11 Aedes aegypti P450 genes from CYP6 and CYP9 subfamilies potentially involved in xenobiotic metabolism were investigated. Many genes were preferentially transcribed in tissues classically involved in xenobiotic metabolism including midgut and Malpighian tubules. Life-stage transcription profiling revealed important variations amongst larvae, pupae, and adult males and females. Exposure of mosquito larvae to sub-lethal doses of three xenobiotics induced the transcription of several genes with an induction peak after 48 to 72 h exposure. Several CYP genes were also induced by oxidative stress and one gene strongly responded to 20-hydroxyecdysone. Overall, this study revealed that these P450s show different transcription profiles according to xenobiotic exposures, life stages or sex. Their putative chemoprotective functions are discussed.

Cite this document (BETA)

Available from Asam Riaz's profile on Mendeley.
Page 1
hidden

Transcription profiling of eleven cytochrome P450s potentially involved in xenobiotic metabolism in the mosquito Aedes aegypti.

Transcription profiling of eleven cytochrome P450s
potentially involved in xenobiotic metabolism in the
mosquito Aedes aegypti
R. Poupardin*, M. A. Riaz*, J. Vontas†, J. P. David*
and S. Reynaud*
*Laboratoire d’Ecologie Alpine (LECA, UMR 5553
CNRS-Université) Grenoble, France; and †Department
of Biology, Faculty of Biotechnology and Applied Biology,
Laboratory Molecular Entomology, University of Crete,
Herakleion, Crete, Greece
Abstractimb_967 1..9
Transcription profiles of 11 Aedes aegypti P450 genes
from CYP6 and CYP9 subfamilies potentially involved
in xenobiotic metabolism were investigated. Many
genes were preferentially transcribed in tissues clas-
sically involved in xenobiotic metabolism including
midgut and Malpighian tubules. Life-stage transcrip-
tion profiling revealed important variations amongst
larvae, pupae, and adult males and females. Exposure
of mosquito larvae to sub-lethal doses of three xeno-
biotics induced the transcription of several genes
with an induction peak after 48 to 72 h exposure.
Several CYP genes were also induced by oxidative
stress and one gene strongly responded to 20-
hydroxyecdysone. Overall, this study revealed that
these P450s show different transcription profiles
according to xenobiotic exposures, life stages or
sex. Their putative chemoprotective functions are
discussed.
Keywords: cytochrome P450 monooxygenases,
CYPs, Aedes aegypti, mosquitoes, gene induction,
xenobiotics, detoxification, insecticides.
Introduction
Cytochrome P450 monooxygenases (P450s or CYPs
for individual proteins/genes) constitute a large ubiquitous
superfamily of heme-containing enzymes (Feyereisen,
2005). Originally identified as monooxygenases, P450s
are now known to catalyse an extremely diverse range of
reactions playing important roles in development, metabo-
lism and in the detoxification of foreign compounds (Scott
et al., 1998). In insects, P450s are involved in the meta-
bolism of endogenous compounds such as steroid
hormones and lipids. Amongst insect P450s, the best
characterized ones are probably Drosophila melanogaster
Halloween genes encoding the P450s involved in steroid
hormone biosynthesis (Gilbert, 2004). Insect P450s are
also involved in the metabolism of exogenous compounds
(xenobiotics) from natural or anthropogenic origins. These
P450s are highly diversified in insects, probably because
of intense coevolution between herbivorous insects and
defensive compounds produced by their host plants
(Schuler, 1996; Berenbaum, 2002). This important genetic
diversity reflects their diverse substrate specificities and
the broad range of chemical reactions they catalyse (Scott
& Wen, 2001).
Another characteristic of P450s is their frequent capac-
ity to be induced by xenobiotics (Feyereisen, 2005). The
relationship between the capacity of insect P450s to
degrade xenobiotics and their ability to be induced by drugs
and chemicals has sometimes been used for identifying
genes responsible for insecticide resistance (Petersen
et al., 2001; Wen et al., 2003). Recently, Wen et al. (2009)
showed that uncommonly encountered phytochemicals, as
well as synthetic substances, can enhance Helicoverpa
zea metabolic activity in an adaptative fashion against both
natural and synthetic toxins. Several studies have revealed
that exposing mosquitoes to various chemicals, including
pollutants and insecticides can increase their tolerance
to insecticides through an induction of P450s (Boyer
et al., 2006; Poupardin et al., 2008; Riaz et al., 2009). How-
ever, Willoughby et al. (2006) showed that Drosophila
P450s involved in dichlorodiphenyltrichloroethane (DDT)
Correspondence: Stéphane Reynaud, Laboratoire d’Ecologie Alpine
(LECA), UMR CNRS-Université 5553, Equipe Perturbations Environne-
mentales et Xénobiotiques, Domaine Universitaire de Saint-Martin
d’Hères, 2233, rue de la piscine Bât D Biologie, BP 53, 38041 Grenoble
Cedex 9, France. Tel.: + 33 0 4 76 51 44 59; fax: + 33 0 4 76 51 44 63;
e-mail: stephane.reynaud@ujf-grenoble.fr
Insect
Molecular
Biology
Insect Molecular Biology (2009) doi: 10.1111/j.1365-2583.2009.00967.x
© 2009 The Authors
Journal compilation © 2009 The Royal Entomological Society 1
Page 2
hidden
resistance were not induced by this insecticide, suggesting
that the relationship between the capacity of an enzyme to
metabolize an insecticide and its induction by the insecti-
cide is not always correlated. Moreover, little is known
about the long term impact of pollutants on the emergence
of metabolic resistances. Müller et al. (2007) pointed out
the fact that the season of intensive use of insecticides
to protect cotton crops in Cameroon coincides with an
increased tolerance of Anopheles arabiensis to pyrethroid
insecticides and an increased transcription of various
P450s. More recently, Djouaka et al. (2008) identified par-
ticular P450s specifically over-transcribed in insecticide-
resistant Anopheles gambiae populations from urban,
agricultural and oil-spillage areas.
Many additional factors such as sex, developmental
stage, hormone titre, tissue expression and stress
response have been involved in insect P450 regulation
(Harrison et al., 2001; Vontas et al., 2005; Le Goff et al.,
2006). Characterizing the response of genes encoding
P450 enzymes to these factors can also be of help for
discerning those involved in xenobiotic degradation from
those involved in other physiological processes (Chung
et al., 2009). In insects, CYP6 and CYP9 families are
over-represented and have been frequently involved in
detoxification of xenobiotics and metabolic resistance to
insecticides (Daborn et al., 2002; David et al., 2005;
Després et al., 2007; Müller et al., 2007; Chiu et al., 2008;
Strode et al., 2008).
Previously, a microarray screening of all Aedes aegypti
detoxification genes allowed us to identify several CYP6s
and CYP9s induced by various xenobiotics including insec-
ticides and pollutants (Poupardin et al., 2008; Riaz et al.,
2009). Some of these P450s, or their orthologues in other
mosquito species, were found to be up-regulated in
insecticide-resistant strains (David et al., 2005; Strode
et al., 2008; Marcombe et al., 2009). In the present study,
transcription profiles of 11 Ae. aegypti CYP6 and CYP9
P450s potentially involved in insecticide resistance or
xenobiotic response were investigated by real-time quan-
titative RT-PCR in order to identify those likely to be
involved in xenobiotic metabolism. Differential transcription
of these genes was investigated in relation to tissues, life
stages and sex. Differential transcription was also investi-
gated in a dynamic way in larvae exposed to sub-lethal
doses of two pollutants and one insecticide. Finally, differ-
ential transcription in relation to oxidative stress and moult-
ing hormone levels was investigated by exposing larvae to
hydrogen peroxide (H2O2) and 20-hydroxyecdysone (20E).
Results and discussion
Protein sequence comparison to other insect P450s
As shown in Table 1, the CYP6Z subfamily has been
frequently associated with resistance to chemical insecti-
cides in An. gambiae. Recently, Chiu et al. (2008)
demonstrated the capacity of An. gambiae CYP6Z1 to
metabolize the insecticides DDT and carbaryl and
McLaughlin et al. (2008) suggested that An. gambiae
CYP6Z2 also possesses a probable role in chemoprotec-
tion. The CYP6M subfamily, represented in our study by
CYP6M6 and CYP6M11, appeared interesting as recent
studies have pointed out its potential role in insecticide
resistance in An. gambiae (Müller et al., 2007; Djouaka
et al., 2008). Recent results indicated that An. gambiae
CYP6M2, similar to Ae. aegypti CYP6M11 and CYP6M6
can metabolize the pyrethroid insecticide permethrin (B.
Stevenson, pers. comm.). Interestingly, the Ae. aegypti
CYP6AL1 did not seem to have a clear orthologue in An.
gambiae but is rather close to the Culex pipiens CYP6F1
previously found over-transcribed in a pyrethroid-resistant
strain (Gong et al., 2005). Finally, Ae. aegypti CYP9s
considered in the present study appeared relatively close
to An. gambiae CYP9s, but none of them or their most
similar insect P450s have yet been associated with
xenobiotic metabolism.
Transcription profiling according to larval tissues,
life-stages and sex
Constitutive transcription profiles of CYP genes were first
investigated in different larval tissues (Fig. 1, left side and
Supporting Information Table S1). Transcription levels of
these P450 genes appeared highly dependent on the
tissues considered and could vary greatly amongst genes
showing high sequence homology. Most analysed P450s
were preferentially transcribed in the alimentary canal
(anterior midgut, midgut and Malpighian tubules) com-
paratively to head and abdomen carcass. All analysed
CYP6Zs, CYP6Ms and CYP6Ns displayed this transcrip-
tion pattern except CYP6Z6 was preferentially transcribed
in head and anterior midgut. Despite 68% cDNA sequence
homology and contiguous genomic location, CYP9M8 and
CYP9M9 showed different transcription profiles in larval
tissues. Both showed a low transcription level in abdomen
carcass, but CYP9M9 was preferentially transcribed in
alimentary canal and under-transcribed in head whereas
CYP9M8 revealed a low transcription level in midgut and
Malpighian tubules. Ai et al. (2009) have shown that two
P450s (CYPA19 and CYPA21) from Bombyx mori with
striking sequence identity have different transcription pat-
terns. CYP9A19 was detectable in the brain, midgut and
testis, whereas CYP9A21 was found in the brain, fat body,
epidermis and ovary, with no expression in the midgut.
This phenomenon might be the consequence of their
recent duplication followed by modification of their pro-
moter sequence leading to different transcription profiles
(Ai et al., 2009). Finally, CYP9J15 was the only CYP being
preferentially transcribed in Malpighian tubules whereas
2 R. Poupardin et al.
© 2009 The Authors
Journal compilation © 2009 The Royal Entomological Society
Page 3
hidden
Table 1. Protein sequence comparison of studied P450s with other insect P450s
Aedes
aegypti
P450
Accession
number
Role in xenobiotic
response or
insecticide
resistance
Most similar
insect P450
Accession
number
Identity
(%) Species
Role in xenobiotic
response or
insecticide
resistance
CYP6Z6 AAEL009123 (1) (3)* CYP6Z2 AGAP008218 62 Anopheles gambiae (5) (6) (7)
CYP6Z3 AGAP008217 61 An. gambiae
CYP6Z1 AGAP008219 58 An. gambiae (5) (7) (8) (10)
CYP6Z4 AGAP002894 60 An. gambiae
CYP6D4 AE003740 41 Drosophila melanogaster (9)
CYP6Z7 AAEL009130 CYP6Z2 AGAP008218 62 An. gambiae (5) (6) (7)
CYP6Z3 AGAP008217 61 An. gambiae
CYP6Z1 AGAP008219 58 An. gambiae (5) (7) (8) (10)
CYP6Z4 AGAP002894 57 An. gambiae
CYP6D4 AE003740 42 D. melanogaster (9)
CYP6Z8 AAEL009131 (2)* (3)* CYP6Z2 AGAP008218 61 An. gambiae (5) (6) (7)
CYP6Z3 AGAP008217 61 An. gambiae
CYP6Z1 AGAP008219 59 An. gambiae (5) (7) (8) (10)
CYP6Z4 AGAP002894 59 An. gambiae
CYP6D4 AE00374 41 D. melanogaster (9)
CYP6Z9 AAEL009129 (4) CYP6Z2 AGAP008218 60 An. gambiae (5) (6) (7)
CYP6Z3 AGAP008217 60 An. gambiae
CYP6Z1 AGAP008219 57 An. gambiae (5) (7) (8) (10)
CYP6Z4 AGAP002894 57 An. gambiae
CYP6D4 AE003740 40 D. melanogaster (9)*
CYP6M6 AAEL009128 (1) (2)* CYP6M3 AGAP008213 61 An. gambiae
CYP6M2 AGAP008212 60 An. gambiae (7)(12)
CYP6M4 AGAP008214 58 An. gambiae
CYP6M1 AGAP008209 56 An. gambiae
CYP6N2 AGAP008206 50 An. gambiae (12)
CYP6M11 AAEL009127 (1) (2)* CYP6M3 AGAP008213 68 An. gambiae
CYP6M2 AGAP008212 66 An. gambiae (7)(12)
CYP6M4 AGAP008214 61 An. gambiae
CYP6M1 AGAP008209 60 An. gambiae
CYP6N2 AGAP008206 51 An. gambiae
CYP6N12 AAEL009124 (2)* (3)* CYP6N1 AGAP008210 60 An. gambiae (12)
CYP6N2 AGAP008206 58 An. gambiae
CYP6M3 AGAP008213 55 An. gambiae
CYP6M2 AGAP008212 54 An. gambiae (7)(12)
CYP6M4 AGAP008214 52 An. gambiae
CYP6AL1 AAEL008889 (2)* (5)* CYP6F1 AB001324 54 Culex pipiens (11)
CYP6BE1 AADG05009058 40 Apis mellifera
CYP6AZ1 AY884043 37 Momomorium destructor
CYP6N1 AGAP008210 39 An. gambiae (12)
CYP6M4 AGAP008214 37 An. gambiae
CYP9M8 AAEL009591 (2)* CYP9M1 AGAP009363 50 An. gambiae
CYP9M2 AGAP009375 47 An. gambiae
CYP9K1 AGAP000818 40 An. gambiae
CYP9E1 AY509245 37 Dasiprocta punctata
CYP9J4 AGAP012292 35 An. gambiae
CYP9M9 AAEL001807 (2)* CYP9M1 AGAP009363 53 An. gambiae
CYP9M2 AGAP009375 53 An. gambiae
CYP9E1 AY509245 39 D. punctata
CYP9K1 AGAP000818 39 An. gambiae
CYP9E2 AF275640 37 Blattella germanica
CYP9J15 AAEL006795 (2)* CYP9J3 AGAP012291 58 An. gambiae
CYP9J4 AGAP012292 48 An. gambiae
CYP9J5 AGAP012296 51 An. gambiae
CYP9E2 AF275640 42 B. germanica
CYP9L2 AGAP012294 43 An. gambiae
Percentages of identities were obtained by comparing protein sequences with known insect P450s from the insect P450 website (http://
p450.sophia.inra.fr) using the BLASTP function. References describing the possible involvement of each P450 in xenobiotic induction (*) or constitutive
insecticide resistance are indicated. Numbers refer to publications. (1) Marcombe et al., 2009, (2) Poupardin et al., 2008, (3) Riaz et al., 2009, (4) Strode
et al., 2008, (5) David et al., 2005, (6) McLaughlin et al., 2008, (7) Müller et al., 2007, (8) Chiu et al., 2008 (9), Willoughby et al., 2006, (10) Nikou et al.,
2003, (11) Gong et al., 2005, (12) Djouaka et al., 2008.
Transcription profiling of P450s in Aedes aegypti 3
© 2009 The Authors
Journal compilation © 2009 The Royal Entomological Society
Page 4
hidden
CYP6AL1 was the only gene preferentially transcribed in
abdomen carcass. In their breeding sites, Aedes larvae
are indiscriminate filter feeders continuously exposed to a
wide range of xenobiotics dissolved in water or bound
to food particles (Aly, 1988). The preferential transcription
of these P450s in the larval alimentary canal might be
related to their ability to metabolize xenobiotics present in
their environment (Li et al., 2008). In Drosophila, CYP6G1
was associated with DDT resistance and was over-
transcribed in the Malpighian tubules, midgut and fat
bodies (Chung et al., 2006; Yang et al., 2007), suggesting
that xenobiotic metabolism may be linked to the renal
function in this species. More generally, 40% of D. mela-
nogaster P450s were found transcribed in the midgut sup-
porting the hypothesis of the alimentary canal being the
main xenobiotic defence tissue (Li et al., 2008). Similarly,
a recent study revealed that most An. gambiae P450s
were over-transcribed in the midgut, hindgut and Mal-
pighian tubules, suggesting that these tissues play a
major role in xenobiotic detoxification (Neira Oviedo et al.,
2008). Yang et al. (2007) suggested that the midgut con-
stitutes the first barrier for ingested chemicals, whereas
the tubules are more likely to handle topically applied
agents that appear in the haemocoel. Our data demon-
strated that Ae. aegypti CYP6Z7, CYP6Z8, CYP6M6,
CYP6M11 and CYP6N12 are preferentially transcribed in
the larval alimentary canal and Malpighian tubules.
Secondly, we investigated the influence of the develop-
ment stage on P450 transcription levels by comparing
fourth stage larvae, pupae, adult males and adult females
(Fig. 1, right side and Supporting Information Table S1).
Most of the P450s studied were over-transcribed in adult
males compared to adult females. All CYP6Zs except
CYP6Z9 followed this pattern. Le Goff et al. (2006) iden-
tified similar transcription patterns for several D. melano-
gaster CYP6 genes. The An. gambiae CYP6Z1 was also
found to be over-transcribed in adult males compared to
adult females in both pyrethroid resistant and susceptible
strains (Nikou et al., 2003). Female mating can regulate
P450s expression and the frequent down-regulation of
P450s in females could result from a trade-off in resource
allocation between reproduction and detoxification
(McGraw et al., 2004). Our results revealed that CYP6Z6,
CYP6Z8, CYP9M9 and CYP9J15 were all over-
transcribed in larvae compared to pupae. During the pupal
stage, mosquitoes do not feed and in consequence are
less exposed to dietary xenobiotics. Therefore, the under-
transcription of P450s involved in dietary xenobiotic
detoxification during this stage is not surprising. Strode
et al. (2006) have described the same transcription
pattern for CYP6Z2 and CYP6Z3 in An. gambiae. Con-
versely, CYP9M8 and CYP6AL1 were both strongly over-
transcribed in pupae compared to larvae (18- and
ninefold, respectively). The over-transcription of these
two P450s at the pupal stage may be linked to metabolic
or hormonal changes during pupation. In Ae. aegypti,
Margam et al. (2006) found an increase in ecdysteroid
level at the beginning of the pupal stage which may affect
the transcription of particular P450s. As for tissue tran-
scription profiles, despite highly similar sequences,
CYP9M9 and CYP9M8 showed a marked differential
transcription in pupae (¥621-fold vs./1.25-fold compara-
tively to adult females) suggesting a different role in pupal
development. Despite different transcription profiles in
larval tissues and pupae, these two P450s were both
highly over-transcribed in larvae compared to the adults
(¥35-fold) suggesting that they may play distinct but
significant roles in larvae.
Transcription profiling in larvae exposed to xenobiotics
The induction capacity of the 11 studied P450s by xeno-
biotics was investigated by exposing larvae to sub-lethal
doses of three different xenobiotics: the polycyclic aro-
H AM M MT C WL L P M F
CYP6Z6
CYP6Z8
CYP6Z7
CYP6Z9
CYP6M6
CYP6M11
CYP6N12
CYP9M8
CYP9M9
CYP9J15
CYP6AL1
Life stageTissue
Fold transcription
x1.5
/1.5
/3.0
/4.5
x3.0
x4.5
1.0
Figure 1. Constitutive transcription profiles of 11 Aedes aegypti P450s across different larval tissues (left) and different life stages (right). Tissues
analysed were: whole larva (WL), head (H), anterior midgut including gastric caeca (AM), midgut (M), Malpighian tubules (MT) and abdomen carcass (C).
Life stages analysed were: fourth-stage larvae (L), pupae (P), 3-day-old adult males (M) and 3-day-old adult females (F). Transcription levels are
expressed as mean fold transcription relative to whole larvae (tissues) or adult females (life-stages). Red and green indicate significant over- and
under-transcription respectively (ratio >1.5-fold in either direction and Mann–Whitney test P-value < 0.05). Yellow indicates no significant transcription
variations. Genes are organized according to their protein sequence homology.
4 R. Poupardin et al.
© 2009 The Authors
Journal compilation © 2009 The Royal Entomological Society
Page 5
hidden
matic hydrocarbon fluoranthene, the pyrethroid insecticide
permethrin and the heavy metal copper (Fig. 2 and Sup-
porting Information Table S2). For each gene, transcrip-
tion levels in larvae exposed to each xenobiotic were
measured up to 96 h following xenobiotic exposure and
normalized according to controls (unexposed larvae).
These experiments confirmed the capacity of particular
P450s to be induced by sub-lethal doses of xenobiotics.
Bearing in mind the low xenobiotic concentrations used,
the maximum peak of induction was observed after 48 to
72 h of exposure. Amongst the 11 analysed genes, six
were induced by fluoranthrene, five by permethrin and
five by copper sulphate. Interestingly, CYP6M11,
CYP6N12 and CYP6AL1 were induced by all xenobiotics.
All genes induced by the three xenobiotics, except
CYP6AL1, were also preferentially transcribed in the ali-
mentary canal (Fig. 1), supporting a significant role of
these tissues in xenobiotic response. Finally, CYP6AL1
displayed a particular transcription profile in larvae
exposed to xenobiotics with marked down-regulation a
few hours after the beginning of exposure followed by
gradual up-regulation. Considering that this gene does
not show tissue and life-stage transcription profiles likely
to be associated with xenobiotic metabolism (see above),
these variations might be the consequence of the stress
generated by xenobiotics and/or the indirect effect of
xenobiotics on larval development.
Transcription variations in response to oxidative
stress and 20E
To investigate the effect of oxidative stress on the 11
P450s studied, Ae. aegypti larvae were exposed to H2O2
for 6 and 24 h (Fig. 3 left side and Supporting Information
Table S3). Several genes including CYP6Z8, CYP6Z9,
CYP6M6, and CYP9M9 were induced by oxidative stress
at one or both time points. Interestingly, most of the genes
induced by H2O2 except CYP6Z9 were induced by at least
one xenobiotic supporting the hypothesis that the induc-
tion of some detoxification genes following xenobiotic
exposure could be the result of oxidative stress (Ding
et al., 2005).
Ctrl 6h 24h 48h 72h 96h Ctrl 6h 24h 48h 72h 96h Ctrl 6h 24h 48h 72h 96h
CYP6Z6
CYP6Z8
CYP6Z7
CYP6Z9
CYP6M6
CYP6M11
CYP6N12
CYP9M8
CYP9M9
CYP9J15
CYP6AL1
etaflus reppoCnirhtemrePenehtnaroulF
Fold transcription
x1.5
/1.5
/3.0
/4.5
x3.0
x4.5
1.0
Figure 2. Transcription profiles of 11 P450s in Aedes aegypti larvae exposed from 6 to 96 h to sub-lethal concentrations of three different xenobiotics:
the polycyclic aromatic hydrocarbon fluoranthene, the pyrethroid insecticide permethrin and the heavy metal copper. For each time point, transcription
levels are expressed as mean fold transcription relative to controls (unexposed larvae). Red and green indicate significant over- and under-transcription
respectively (ratio >1.5-fold in either direction and Mann–Whitney test P-value < 0.05). Yellow indicates no significant transcription variations. Genes are
organized according to their protein sequence homology.
Ctrl 6h 24h Ctrl 6h 24h
CYP6Z6
CYP6Z8
CYP6Z7
CYP6Z9
CYP6M6
CYP6M11
CYP6N12
CYP9M8
CYP9M9
CYP9J15
CYP6AL1
20-E 5 mg/LH2O2 0.025%
Fold transcription
x1.5
/1.5
/3.0
/4.5
x3.0
x4.5
1.0
Figure 3. Transcription profiles of 11 P450s in Aedes
aegypti larvae exposed to sub-lethal concentrations
of hydrogen peroxide (H2O2) and
20-hydroxyecdysone (20E). Larvae were exposed
during 6 and 24 h to 0.025% of H2O2 and 5 mg/l 20E.
For each time point, transcription levels are
expressed as mean fold transcription relative to
controls (unexposed larvae). Red and green indicate
significant over- and under-transcription respectively
(ratio >1.5-fold in either direction and Mann–Whitney
test P-value < 0.05). Yellow indicates no significant
transcription variations. Genes are organized
according to their protein sequence homology.
Transcription profiling of P450s in Aedes aegypti 5
© 2009 The Authors
Journal compilation © 2009 The Royal Entomological Society
Page 6
hidden
Differential P450 transcription during mosquito develop-
ment may be explained by hormonal variations such as
moulting hormone fluctuations. To test this hypothesis,
mosquito larvae were exposed to 20E, the active moulting
hormone for 6 and 24 h (Fig. 3 right side and Supporting
Information Table S3). Only CYP6AL1 showed a strong
response to 20E, suggesting that this gene may play a
significant role in moults, metamorphosis and/or hormone
metabolism. This hypothesis is supported by a chaotic
xenobiotic induction profile, a preferential transcription
in the abdomen carcass and an over-transcription in
pupae. Similarly, CYP9M8, found over-transcribed in
pupae and down-regulated in the alimentary canal, slightly
responded to 20E, suggesting that this gene may also
have a possible role in endogenous metabolism.
Conclusion
In the present study, transcription profiles of 11 Ae. aegypti
CYP6s and CYP9s were investigated in order to identify
those possibly involved in xenobiotic metabolism. Follow-
ing these results, most CYP6Zs but also CYP6M11,
CYP6M6 and CYP6N12 are all preferentially transcribed
in typical detoxification tissues and larvae or adult males.
Most of these genes are also inducible by various xeno-
biotics and oxidative stress. Although the unambiguous
functional characterization of these enzymes requires
further experimental work such as heterologous expres-
sion followed by in vitro metabolism studies, these P450s
are likely to have a chemoprotective role in Ae. aegypti.
Experimental procedures
Choice of studied P450s and sequence analysis
Candidate Ae. aegypti CYP genes were chosen for their ability to
be induced by pesticides or pollutants (Poupardin et al., 2008;
Riaz et al., 2009) and for their putative role in insecticide resis-
tance according to the literature (Table 1). Considering the high
sequence similarity of CYP6Zs, we decided to analyse the tran-
scription profile of all subfamily members. For each P450, protein
sequence was compared to other available insect P450s by using
the local BLASTP function available at the insect P450 website
(http://p450.sophia.inra.fr). For each P450, only the five BLASTP
hits showing the smallest E-values were considered. The involve-
ment of those similar insect P450s in insecticide resistance
and/or xenobiotic induction was reported based on the existing
literature.
Mosquitoes and sample preparation
A laboratory Ae. aegypti strain susceptible to insecticides (Bora-
Bora strain) was reared in standard insectary conditions (27 °C,
16 h/8 h light/dark period, 80% relative humidity) and used for
all experiments. Larvae were reared in tap water and fed with
standard larval food (hay pellets). Each experiment was per-
formed with three independent egg batches from different
generations (three biological replicates).
P450 transcription profiles were first investigated at four differ-
ent life stages: fourth-stage larvae, pupae, adult males and adult
females (3-days post emergence, nonblood-fed). For each bio-
logical replicate, 30 fresh individuals of each life stage were
collected and immediately used for RNA extractions.
Transcription profiles were then investigated in different larval
tissues obtained by dissecting fourth stage larvae. The different
larval tissues studied were: whole larvae (WL), head (H), anterior
midgut including gastric caeca (AM), midgut (M), Malpighian
tubules and hindgut (MT) and carcass from abdomens (C).
Tissues were dissected from more than 200 fresh larvae in
ice-cold RNAlater (Ambion, Austin, TX, USA) and stored in
RNAlater at 4 °C until RNA extractions.
The capacity of P450s to be induced by xenobiotics was
investigated by exposing larvae to three different xenobiotics for
6 to 96 h. To avoid any bias because of pupation during xeno-
biotic exposure, third-stage larvae were used for exposure,
leading to fourth-stage larvae after 96 h exposure. Xenobiotics
used for larval exposure were: the polycyclic aromatic hydro-
carbon fluoranthene (Aldrich, Saint-Louis, MO, USA), the pyre-
throid insecticide permethrin (Chem Service, West Chester,
PA, USA) and the heavy metal copper (obtained from copper
sulphate; Prolabo, France). Concentrations used for larval
exposure were chosen according to the concentrations likely
to be found in highly polluted environments (INERIS, http://
www.ineris.fr). For the insecticide permethrin, a concentration of
1 mg/l resulting in less than 5% larval mortality after 96 h expo-
sure was chosen. For the other xenobiotics, no larval mortality
was observed during exposure and doses of 25 mg/l and 1 mg/l
were chosen for fluoranthene and copper sulphate, respectively.
Time-points chosen for monitoring gene transcription compara-
tively to unexposed larvae were 6, 24, 48, 72 and 96 h after the
beginning of exposure. Exposures to all xenobiotics were per-
formed in six replicates of 100 homogenous 2-day-old larvae in
200 ml tap water and 50 mg larval food (ground hay pellets). At
each time point, three ¥ 30 larvae were collected, rinsed twice
in tap water and immediately used for RNA extractions.
The capacity of P450s to respond to oxidative stress and moult-
ing hormone level was investigated by exposing fourth-stage
larvae to H2O2 (Sigma-Aldrich, Saint-Louis, MO, USA) and puri-
fied 20E kindly provided by Dr C. Dauphin-Villemant (Univ. Pierre
et Marie Curie, France). Preliminary experiments allowed us to
choose a concentration of H2O2 resulting in less than 5% mortality
after 24 h. Similarly, a concentration of 20E resulting in no larval
mortality and no modification of larval development time was
chosen. Fourth-stage larvae were exposed during 6 and 24 h to
0.025% H2O2 or 5 mg/l 20E. Exposures were repeated three
times with different egg batches. At each time point, 30 larvae
were collected, rinsed twice in tap water and immediately used for
RNA extractions.
RNA extractions and real-time quantitative RT-PCR
Total RNAs from each sample were extracted using Trizol
(Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s
instructions. Four micrograms of total RNAs were treated with
DNAse I (Invitrogen) for 20 min at 20 °C and used for cDNA
synthesis with Superscript III (Invitrogen) and oligo-dT20 primer
(Invitrogen) for 60 min at 50 °C according to the manufacturer’s
6 R. Poupardin et al.
© 2009 The Authors
Journal compilation © 2009 The Royal Entomological Society
Page 7
hidden
instructions. Resulting cDNAs were diluted 100 times in ultra-high
quality water for real-time quantitative RT-PCR reactions. Real-
time quantitative PCR reactions of 25 ml were performed on an
iQ5 system (BioRad, Hercules, CA, USA) using MesaGreen
Supermix (Eurogentec, Liège, Belgium), 0.3 mM of each primer
and 5 ml of diluted cDNAs according to the manufacturers’
instructions. For each gene analysed, a cDNA dilution scale
from five to 50 000 times was performed in order to assess
PCR efficiency and quantitative differences amongst samples.
For each gene analysed, a melt curve analysis was performed
to check for the unique presence of the targeted PCR product
and the absence of significant primer dimers. Primers used for
real-time quantitative PCR are listed in Table 2. Data analysis
was performed according to the DDCt method taking into
account PCR efficiency (Pfaffl, 2001) and using the housekeep-
ing genes encoding the ribosomal protein L8 (AeRPL8,
GenBank accession no.: DQ440262) and the ribosomal protein
S7 (AeRPS7, GenBank accession no.: EAT38624.1) for a dual-
gene normalization. For xenobiotic exposure experiments,
results were expressed as mean transcription ratios (fold)
between larvae exposed to each xenobiotics and controls at
each time point. For life-stage experiments, results were
expressed as mean transcription ratios (fold) relative to adult
females. For tissue experiments, results were expressed as
mean transcription ratios (fold) relative to whole larvae. Quan-
titative RT-PCR data were computed by using a Mann–Whitney
test on transcription ratios (H0: transcription ratio = 1). Genes
were considered significantly over-transcribed when the
transcription ratio minus SE was superior to 1.5 and the Mann–
Whitney P-value was <0.05. Reciprocally, genes were consid-
ered significantly under-transcribed when transcription ratio
plus SE was inferior to 0.67 (corresponding to 1.5-fold under-
transcription) and the Mann–Whitney P-value was <0.05.
Acknowledgements
This research project was funded by the French National
Research Agency (Agence Nationale de la Recherche,
ANR ‘Santé-Environnement Santé-travail’) grant
MOSQUITO-ENV N° 07SEST014. We are grateful to Dr
Chantal Dauphin-Villemant for providing purified 20E and
useful comments on the manuscript. We thank J. Patou-
raux for technical help and mosquito rearing and Profes-
sor P. Ravanel for useful comments on the manuscript.
We thank Dr Eric Coissac for providing advice on the
statistical analysis.
References
Ai, J., Yu, Q., Cheng, T., Dai, F., Zhang, X., Zhu, Y. et al. (2009)
Characterization of multiple CYP9A genes in the silkworm,
Bombyx mori. Mol Biol Rep, doi: 10.1007/511033-009-
09580-9.
Aly, C. (1988) Filtration rates of mosquito larvae in suspensions of
latex microspheres and yeast cells. Entomol Exp Appl 46:
55–61.
Berenbaum, M.R. (2002) Postgenomic chemical ecology: from
genetic code to ecological interactions. J Chem Ecol 28: 873–
896.
Boyer, S., David, J.P., Rey, D., Lemperiere, G. and Ravanel, P.
(2006) Response of Aedes aegypti (Diptera: Culicidae) larvae
Table 2. Primers used for quantitative real-time PCR experiments
Primer Sequence (5′ to 3′) Annealing temperature* Product length Product Tm
CYP6Z6_forward CTGCCTTATTTGGACTTATGC 54.5 113 79
CYP6Z6_reverse ATCACAACACTGGATTCTGG
CYP6Z8_forward AGGTTGTGATCCCATTGC 52 172 80
CYP6Z8_reverse ACCATTACGCCCATTCTG
CYP6Z7_forward TGTAGAGTCTTGCGGGAAG 54 157 82.5
CYP6Z7_reverse CGATTTGTTCAGTCACGATTC
CYP6Z9_forward TTTGCCCTGGACTGCTTAG 55 138 81
CYP6Z9_reverse GTTGCTGGATGAAATCTTTACG
CYP6M6_forward CAGTTCAGCGAGTATATGG 52 198 82
CYP6M6_reverse ATCTTTCTTCCTATTCCTTGG
CYP6M11_forward AGGTTAAGCAGGAGAGTG 51 198 82.5
CYP6M11_reverse CCTTAGGCATAGTGTTCATC
CYP6N12_forward TGGGTGCTGTGAGGGATAC 54.5 122 78.5
CYP6N12_reverse AGTCAATGTCTCTGTGTTGCC
CYP9M8_forward TCCAGAACACCTTGCCAAC 54 78 76
CYP9M8_reverse CTTACAATGCCATTATCCAAACG
CYP9M9_forward AAGGAGATTGGGAAATGATGTG 58 107 79
CYP9M9_reverse TTGACAAACGCTTTCCATACTG
CYP9J15_forward CCGCAGAAGAGTCCCAAG 54.5 98 83
CYP9J15_reverse GAACCCAGCCGAGAAGAAG
CYP6AL1_forward CAACGCTGATGTCATTCTG 52 189 81.5
CYP6AL1_reverse GGAACGATACTGGAGGATG
*Annealing temperatures were chosen according to optimal PCR efficiency and primer specificity.
Product TM, product melting temperature.
Transcription profiling of P450s in Aedes aegypti 7
© 2009 The Authors
Journal compilation © 2009 The Royal Entomological Society
Page 8
hidden
to three xenobiotic exposures: larval tolerance and detoxifying
enzyme activities. Environ Toxicol Chem 25: 470–476.
Chiu, T.L., Wen, Z., Rupasinghe, S.G. and Schuler, M.A. (2008)
Comparative molecular modeling of Anopheles gambiae
CYP6Z1, a mosquito P450 capable of metabolizing DDT. Proc
Natl Acad Sci USA 105: 8855–8860.
Chung, H., Bogwitz, M.R., McCart, C., Andrianopoulos, A.,
Ffrench-Constant, R.H., Batterham, P. et al. (2006) Cis-
regulatory elements in the Accord retrotransposon result in
tissue-specific expression of the Drosophila melanogaster
insecticide resistance gene Cyp6g1. Genetics 175: 1071–
1077.
Chung, H., Sztal, T., Pasricha, S., Sridhar, M., Batterham, P. and
Daborn, P.J. (2009) Characterization of Drosophila melano-
gaster cytochrome P450 genes. Proc Natl Acad Sci USA 106:
5731–5736.
Daborn, P.J., Yen, J.L., Bogwitz, M.R., Le Goff, G., Feil, E., Jeffers,
S. et al. (2002) A single p450 allele associated with insecticide
resistance in Drosophila. Science 297: 2253–2256.
David, J.P., Strode, C., Vontas, J., Nikou, D., Vaughan, A., Pig-
natelli, P.M. et al. (2005) The Anopheles gambiae deto-
xification chip: a highly specific microarray to study
metabolic-based insecticide resistance in malaria vectors.
Proc Natl Acad Sci USA 102: 4080–4084.
Després, L., David, J.P. and Gallet, C. (2007) The evolutionary
ecology of insect resistance to plant chemicals. Trends Ecol
Evol 22: 298–307.
Ding, Y., Hawkes, N., Meredith, J., Eggleston, P., Hemingway, J.
and Ranson, H. (2005) Characterization of the promoters of
Epsilon glutathione transferases in the mosquito Anopheles
gambiae and their response to oxidative stress. Biochem J
387: 879–888.
Djouaka, R.F., Bakare, A.A., Coulibaly, O.N., Akogbeto, M.C.,
Ranson, H., Hemingway, J. et al. (2008) Expression of the
cytochrome P450s, CYP6P3 and CYP6M2 are significantly
elevated in multiple pyrethroid resistant populations of Anoph-
eles gambiae s.s. from Southern Benin and Nigeria. BMC
Genomics 9: 538.
Feyereisen, R. (2005) Insect Cytochrome P450. In Comprehen-
sive Molecular Insect Science (Gilbert, L.I., Iatrou, K. and Gill,
S., eds), pp. 1–77. Elsevier, Oxford.
Gilbert, L.I. (2004) Halloween genes encode P450 enzymes that
mediate steroid hormone biosynthesis in Drosophila melano-
gaster. Mol Cell Endocrinol 215: 1–10.
Gong, M.Q., Gu, Y., Hu, X.B., Sun, Y., Ma, L., Li, X.L. et al.
(2005) Cloning and overexpression of CYP6F1, a cyto-
chrome P450 gene, from deltamethrin-resistant Culex pipiens
pallens. Acta Biochim Biophys Sin (Shanghai) 37: 317–326.
Harrison, T.L., Zangerl, A.R., Schuler, M.A. and Berenbaum, M.R.
(2001) Developmental variation in cytochrome P450 expres-
sion in Papilio polyxenes in response to xanthotoxin, a host-
plant allelochemical. Arch Insect Biochem Physiol 48: 179–
189.
Le Goff, G., Hilliou, F., Siegfried, B.D., Boundy, S., Wajnberg, E.,
Sofer, L. et al. (2006) Xenobiotic response in Drosophila
melanogaster: sex dependence of P450 and GST gene induc-
tion. Insect Biochem Mol Biol 36: 674–682.
Li, H.M., Buczkowski, G., Mittapalli, O., Xie, J., Wu, J., Wester-
man, R. et al. (2008) Transcriptomic profiles of Drosophila
melanogaster third instar larval midgut and responses to oxi-
dative stress. Insect Mol Biol 17: 325–339.
McGraw, L.A., Gibson, G., Clark, A.G. and Wolfner, M.F. (2004)
Genes regulated by mating, sperm, or seminal proteins in
mated female Drosophila melanogaster. Curr Biol 14: 1509–
1514.
McLaughlin, L.A., Niazi, U., Bibby, J., David, J.P., Vontas, J.,
Hemingway, J. et al. (2008) Characterization of inhibitors and
substrates of Anopheles gambiae CYP6Z2. Insect Mol Biol
17: 125–135.
Marcombe, S., Poupardin, R., Darriet, F., Reynaud, S., Bonnet,
J., Strode, C. et al. (2009) Exploring the molecular basis of
insecticide resistance in the dengue vector Aedes aegypti: a
case study in Martinique Island (French West Indies). BMC
Genomics 10: 494.
Margam, V.M., Gelman, D.B. and Palli, S.R. (2006) Ecdysteroid
titers and developmental expression of ecdysteroid-regulated
genes during metamorphosis of the yellow fever mosquito,
Aedes aegypti (Diptera: Culicidae). J Insect Physiol 52: 558–
568.
Müller, P., Donnelly, M.J. and Ranson, H. (2007) Transcription
profiling of a recently colonised pyrethroid resistant Anopheles
gambiae strain from Ghana. BMC Genomics 8: 36.
Neira Oviedo, M., Vanekeris, L., Corena-McLeod, M.D. and
Linser, P.J. (2008) A microarray-based analysis of transcrip-
tional compartmentalization in the alimentary canal of Anoph-
eles gambiae (Diptera: Culicidae) larvae. Insect Mol Biol 17:
61–72.
Nikou, D., Ranson, H. and Hemingway, J. (2003) An adult-
specific CYP6 P450 gene is overexpressed in a pyrethroid-
resistant strain of the malaria vector, Anopheles gambiae.
Gene 318: 91–102.
Petersen, R.A., Zangerl, A.R., Berenbaum, M.R. and Schuler,
M.A. (2001) Expression of CYP6B1 and CYP6B3 cytochrome
P450 monooxygenases and furanocoumarin metabolism in
different tissues of Papilio polyxenes (Lepidoptera : Papilion-
idae). Insect Biochem Mol Biol 31: 679–690.
Pfaffl, M.W. (2001) A new mathematical model for relative
quantification in real-time RT-PCR. Nucleic Acids Res 29:
e45.
Poupardin, R., Reynaud, S., Strode, C., Ranson, H., Vontas, J.
and David, J.P. (2008) Cross-induction of detoxification genes
by environmental xenobiotics and insecticides in the mosquito
Aedes aegypti: impact on larval tolerance to chemical insec-
ticides. Insect Biochem Mol Biol 38: 540–551.
Riaz, M.A., Poupardin, R., Reynaud, S., Strode, C., Ranson, H.
and David, J.P. (2009) Impact of glyphosate and benzo[a]py-
rene on the tolerance of mosquito larvae to chemical insecti-
cides. Role of detoxification genes in response to xenobiotics.
Aquat Toxicol 93: 61–69.
Schuler, M.A. (1996) The role of cytochrome P450 monooxyge-
nases in plant-insect interactions. Plant Physiol 112: 1411–
1419.
Scott, J.G. and Wen, Z. (2001) Cytochromes P450 of insects: the
tip of the iceberg. Pest Manag Sci 57: 958–967.
Scott, J.G., Liu, N. and Wen, Z. (1998) Insect cytochromes P450:
diversity, insecticide resistance and tolerance to plant toxins.
Comp Biochem Physiol C Pharmacol Toxicol Endocrinol 121:
147–155.
Strode, C., Steen, K., Ortelli, F. and Ranson, H. (2006) Differential
expression of the detoxification genes in the different life
stages of the malaria vector Anopheles gambiae. Insect Mol
Biol 15: 523–530.
8 R. Poupardin et al.
© 2009 The Authors
Journal compilation © 2009 The Royal Entomological Society
Page 9
hidden
Strode, C., Wondji, C.S., David, J.P., Hawkes, N.J., Lumjuan, N.,
Nelson, D.R. et al. (2008) Genomic analysis of detoxification
genes in the mosquito Aedes aegypti. Insect Biochem Mol Biol
38: 113–123.
Vontas, J., Blass, C., Koutsos, A.C., David, J.P., Kafatos, F.C.,
Louis, C. et al. (2005) Gene expression in insecticide
resistant and susceptible Anopheles gambiae strains consti-
tutively or after insecticide exposure. Insect Mol Biol 14: 509–
521.
Wen, Z.M., Pan, L.P., Berenbaum, M.R. and Schuler, M.A. (2003)
Metabolism of linear and angular furanocoumarins by Papilio
polyxenes CYP6B1 co-expressed with NADPH cytochrome
P450 reductase. Insect Biochem Mol Biol 33: 937–947.
Wen, Z., Zeng, R.S., Niu, G., Berenbaum, M.R. and Schuler, M.A.
(2009) Ecological significance of induction of broad-substrate
cytochrome P450s by natural and synthetic inducers in Heli-
coverpa zea. J Chem Ecol 35: 183–189.
Willoughby, L., Chung, H., Lumb, C., Robin, C., Batterham, P. and
Daborn, P.J. (2006) A comparison of Drosophila melanogaster
detoxification gene induction responses for six insecticides,
caffeine and phenobarbital. Insect Biochem Mol Biol 36: 934–
942.
Yang, J., McCart, C., Woods, D.J., Terhzaz, S., Greenwood, K.G.,
ffrench-Constant, R.H. et al. (2007) A Drosophila systems
approach to xenobiotic metabolism. Physiol Genomics 30:
223–231.
Supporting Information
Additional Supporting Information may be found in the
online version of this article under the DOI reference: DOI
10.1111/j.1365-2583.2009.00967.x
Table S1. Constitutive transcription profiles of 11 Aedes aegypti P450s
across different larval tissues and different life stages.
Table S2. Transcription profiles of 11 P450s in Aedes aegypti larvae
exposed to three different xenobiotics.
Table S3. Transcription profiles of 11 P450s in Aedes aegypti larvae
exposed to hydrogen peroxide and 20-hydroxyecdysone.
Please note: Wiley-Blackwell are not responsible for the
content or functionality of any supporting materials
supplied by the authors. Any queries (other than missing
material) should be directed to the corresponding author
for the article.
Transcription profiling of P450s in Aedes aegypti 9
© 2009 The Authors
Journal compilation © 2009 The Royal Entomological Society

Sign up today - FREE

Mendeley saves you time finding and organizing research. Learn more

  • All your research in one place
  • Add and import papers easily
  • Access it anywhere, anytime

Start using Mendeley in seconds!

Already have an account? Sign in

Readership Statistics

6 Readers on Mendeley
by Discipline
 
by Academic Status
 
50% Ph.D. Student
 
17% Post Doc
 
17% Researcher (at an Academic Institution)
by Country
 
50% France
 
17% United Kingdom
 
17% Brazil