Vascular Endothelial Growth Factor-C and C-C Chemokine Receptor 7
in Tumor Cell–Lymphatic Cross-talk Promote Invasive Phenotype
Amine Issa,
1
Thomas X. Le,
2
Alexander N. Shoushtari,
2
Jacqueline D. Shields,
1
and Melody A. Swartz
1,2
1
Institute of Bioengineering, E
´
cole Polytechnique Fe´de´rale de Lausanne (EPFL), Lausanne, Switzerland and
2
Department of
Biomedical Engineering, Northwestern University, Evanston, Illinois
Abstract
Most carcinomas spread to distant sites through lymphatic
vessels. Several preclinical and clinical studies have shown a
positive correlation between the incidence of lymph node
metastasis and secretion of the lymphatic growth factor
vascular endothelial growth factor-C (VEGF-C)by tumor cells,
suggesting tumor lymphangiogenesis as an escape mecha-
nism. However, recent evidence has shown VEGF receptor-3
(VEGFR-3)expression on tumor cells and autocrine signaling,
which increase metastatic potential. Furthermore, there is
growing evidence implicating lymphatic-homing chemokine
receptors, particularly C-C chemokine receptor 7 (CCR7),
in lymph node metastasis. We report here that expressions
of VEGF-C and CCR7 by tumor cells act synergistically to
promote their invasion toward lymphatics. First, VEGF-C acts
to increase lymphatic secretion of CCL21, which in turn drives
CCR7-dependent tumor chemoinvasion toward lymphatics.
Second, VEGF-C acts in an autocrine fashion to increase
tumor invasiveness by increasing the proteolytic activity and
motility of tumor cells in a three-dimensional matrix. Both of
these effects are VEGFR-3 dependent and evident only in
three-dimensional environments. We further verified that
VEGF-C induces lymphatic CCL21 up-regulation in vivo by
direct injection of VEGF-C protein intradermally in the mouse.
Taken together, these results bridge the prometastatic
functions of CCR7 and VEGF-C in tumors and show that,
beyond lymphangiogenesis, VEGF-C promotes tumor invasion
toward lymphatics by both autocrine and CCR7-dependent
paracrine signaling mechanisms, which may be a significant
cause of lymph node metastasis. [Cancer Res 2009;69(1):349–57]
Introduction
The most common carcinomas spread to distant sites via
lymphatic vessels, but the mechanisms of tumor cell escape into
lymphatic vessels remain unclear. Most likely, lymphatic metastasis
involves both invasion toward surrounding lymphatic vessels and
either induction of new lymphatic sprouts into the tumor or
expansion of peritumoral lymphatic vessels (1, 2). In human
biopsies, tumors are often seen invading their surrounding stromal
tissue and entering peritumoral lymphatics. Tumor expression of
lymphangiogenic factors, specifically vascular endothelial growth
factor-C (VEGF-C) and VEGF-D, has been correlated with
lymphatic metastasis both in humans and in animal models
(3–6). For example, one report showed serum VEGF-C levels in
patients with squamous cell carcinoma of the esophagus to be on
the order of 16 to 22 ng/mL, compared with 11 ng/mL for healthy
patients (7). Because the expression of the primary receptor of
VEGF-C and VEGF-D, VEGF receptor-3 (VEGFR-3), is largely
restricted to lymphatic endothelial cells (LEC; ref. 1), it has been
assumed, and in many cases reported, that VEGF-C–induced
tumor lymphangiogenesis is the primary mechanism underlying
VEGF-C–enhanced lymphatic metastasis (4, 6, 8).
However, other studies have reported that whereas VEGF-C
correlates with metastasis and invasion, tumor lymphangiogenesis
does not necessarily (9–14), suggesting alternative functional roles
for VEGF-C and VEGFR-3 signaling. For example, Hoshida and
colleagues (15) showed, using intravital microscopy, that VEGF-C
increases invasion of tumor cells into draining lymphatic vessels.
Furthermore, several recent studies have shown that both VEGFR-3
and VEGF-C are expressed by metastatic tumor cells (16–21),
suggesting autocrine stimulation mechanisms that may include
tumor cell proliferation (19, 22) and invasiveness (21, 23, 24) of
tumor cells, directly or indirectly by increasing flow into
hyperplastic peritumoral lymphatics (11, 15). These findings
suggest that VEGF-C may act in multiple ways to promote
lymphatic invasion.
Another factor strongly correlated to lymphatic metastasis is
C-C chemokine receptor 7 (CCR7), which plays a critical role in
lymphocyte homing toward lymphatic vessels and to secondary
lymphoid organs including the lymph nodes (25–27). Dendritic
cells up-regulate CCR7 on activation and during maturation to
respond to lymphatic-secreted CCL21 (also known as SLC and
6cKine), which binds CCR7 to elicit directional migration. In CCR7-
deficient mice, peripheral dendritic cells fail to migrate to the
draining lymph nodes following activation (25). Lymph nodes are
also a rich source of the CCR7 ligands CCL21 and CCL19 (also
known as ELC and exodus-3), secreted by reticular stromal cells,
high endothelial venules, and other immune cells (26). Because
CCR7 expression has been correlated with lymph node metastasis
of cervical, colorectal, gastric, mammary, esophageal, lung, and
prostate carcinomas (28–33), it is hypothesized that tumor cells use
the same mechanisms as immune cells to home to lymphatics,
namely, with CCR7 guiding them up CCL21 gradients (34, 35).
Additionally, we have recently shown that tumor cells can use
CCR7 and autologous secretion of CCL19 and CCL21 as a ‘‘flow
sensing’’ mechanism to home to lymphatics because the pericel-
lular distributions can become biased in the flow direction, causing
downstream gradients that then guide the tumor cell to the
draining lymphatic (36).
The aims of this study were twofold: First, to determine the
mechanisms of enhancement of tumor invasiveness by CCR7 and
Note: Supplementary data for this article are available at Cancer Research Online
(http://cancerres.aacrjournals.org/).
Requests for reprints: Melody A. Swartz, Institute of Bioengineering, School of Life
Sciences/LMBM/Station 15, E
´
cole Polytechnique Fe´de´rale de Lausanne (EPFL), 1015
Lausanne, Switzerland. Phone: 41-21-693-9686; Fax: 41-21-693-1660; E-mail: melody.
swartz@epfl.ch.
I2009 American Association for Cancer Research.
doi:10.1158/0008-5472.CAN-08-1875
www.aacrjournals.org
349
Cancer Res 2009; 69: (1). January 1, 2009
Research Article

VEGF-C, and second, to determine whether any correlation or
synergy exists between CCR7 and VEGF-C expression by tumor
cells in promoting invasion toward lymphatics. We report here that
VEGF-C enhances tumor cell chemoinvasion toward lymphatics in
two ways: (a) by inducing lymphatics to increase their secretion
of CCL21 to enhance paracrine signaling by LECs to CCR7-
expressing tumor cells, and (b) by autologous ligation of tumor
VEGFR-3, which is expressed in low levels when tumor cells are in
a three-dimensional environment, leading to an increase in the
proteolytic activity of the tumor cell and thereby enhancing its
migration potential. These effects of VEGF-C both on tumor cells
themselves and on lymphatic endothelium to enhance tumor
chemoinvasion offer an alternative mechanism to explain why
VEGF-C and CCR7 both correlate with enhanced metastatic
potential of tumors to lymph nodes.
Materials and Methods
Neutralizing antibodies and human recombinant proteins. Neutral-
izing antibodies against human VEGFR-2(IMC-1121a) and VEGFR-3
(hf4-3C5) along with a matching control IgG were kind gifts from ImClone
Systems, Inc. The antibodies were used at concentrations of 10 Ag/mL for
hf4-3C5 and 20 Ag/mL for the control IgG and IMC-1121a. Goat anti-human
CCL21 and mouse anti-human CCR7 neutralizing antibodies (AF366 and
MAB197, respectively; R&D Systems) were used at concentrations of 4 and
5 Ag/mL, respectively. Recombinant human CCL21 and rhVEGF-C (both
from R&D Systems) were used at concentrations of 350 and 100 ng/mL,
respectively. For the in vivo study, rhVEGF-C and rhVEGF-A165 (R&D
Systems) were injected into mouse skin at 10 ng/mouse.
Cell lines and culture. MDA-MB-435s cells were obtained from
American Type Culture Collection (ATCC), and two stably transfected
versions of these cells, VEGF-C–overexpressing, green fluorescent protein
(GFP)–transfected MDA-MB-435 cells and their control-transfected coun-
terparts, referred to herein as VTs and CTs, were a kind gift from Mihaela
Skobe (6). They were maintained in DMEM supplemented with 10% fetal
bovine serum (FBS) and 1% penicillin-streptomycin-amphotericin B
supplemented with 600 Ag/mL zeocin and 400 Ag/mL geneticin (all from
Life Technologies, Inc.). ZR75-1 (invasive mammary carcinoma) cells were
obtained from ATCC and were maintained in RPMI 1640 supplemented
with 10% FBS, 1% penicillin-streptomycin, 1.0 mmol/L sodium pyruvate,
10 mmol/L HEPES, and 2.5 g/L D-glucose (Life Technologies). U2OS
(osteosarcoma) cells, a kind gift from Ivan Stamenkovic, were maintained in
DMEM supplemented with 10% FBS and 1% penicillin-streptomycin.
Human dermal LECs were isolated from neonatal foreskin as described
(37) and maintained in endothelial basal medium (Cambrex) supplemented
with 20% FBS (Life Technologies), 1% penicillin-streptomycin-amphotericin
B (Life Technologies), 1 Ag/mL hydrocortisone, and 50 Amol/L DBcAMP
(both from Sigma); they were used between passages 6 and 9. Human
umbilical vein endothelial cells (HUVEC; Promocell) were cultured in the
same media as LECs and used between passages 6 and 8.
Three-dimensional chemoinvasion assay. To determine relative
chemoinvasiveness between tumor cells and endothelial cells and the
effects of tumor secretion of VEGF-C on these interactions, we used
12-mm, 8-Am-pore cell culture inserts (Millipore) with CTs, VTs, HUVECs,
and LECs [the latter two being labeled with cell tracker red (CMRA,
Invitrogen)]. The underside was seeded with one cell type (attracting cell)
whereas the upper side was seeded with the migratory cell type within a
three-dimensional collagen matrix. Specifically, the underside of each well
was seeded with 200,000 cells (of the chemoattracting cell type) and
incubated for 4 h to allow cells to attach. Then the inserts were filled with
100 AL of type I collagen (2.0 mg/mL; BD Biosciences) containing 100,000
cells (of the migratory cell type) in basal medium supplemented with 2%
FBS. The following cocultures were used (upper-lower): HUVEC-CT;
HUVEC-VT; LEC-CT; LEC-VT; CT-HUVEC; CT-LEC; VT-HUVEC; VT-LEC;
and the controls, HUVEC-null, LEC-null, CT-null, and VT-null. After
incubation for 24 h in a 37jC/5% CO
2
incubator, nonmigrated cells were
removed and the inserts were fixed in 2% paraformaldehyde. The
membrane was removed and mounted with Vectashield containing 4¶,6-
diamidino-2-phenylindole (Vector Labs); images were captured using a
Zeiss Axiovert 220 fluorescence microscope with an Axiocam MRm
camera; and the number of migrated cells was counted to allow
calculation of normalized migration.
To determine the chemotactic functionality of tumor CCR7 and VEGFR-
3, another panel of chemoinvasion assays were carried out as above, with
tumor cells seeded in three-dimensional collagen gels within Millipore
inserts and 350 ng/mL CCL21 or 100 ng/mL VEGF-C added to the bottom
well after serum starvation overnight. In some wells, blocking antibody was
added to both top and bottom chambers: 10 Ag/mL hF4-3C5, 20 Ag/mL
IMC-1121a, or both. Analysis of migrated cells was identical to that
described above.
Horizontal three-dimensional migration model. A second type of
three-dimensional migration assay was established to directly observe
interactions between tumor cells and lymphatic or blood endothelial cells
(LECs and HUVECs). Using a Lab-Tek four-chambered cover glass system
(Nalge Nunc), two adjacent collagen gels (2.5 mg/mL) were cast in each
chamber by blocking half the well with a precast PDMS plug while the
first gel set, then removing it to pour the second gel. Each gel contained
either tumor cells, LECs, or HUVECs at a cell density of 5
10
5
/mL, or gel
alone. HUVECs and LECs were loaded with cell tracker red CMRA
(Invitrogen) according to the manufacturer’s instructions before being
suspended in the gel to differentiate them from the GFP-transfected tumor
cells. After polymerization, basal DMEM supplemented with 2% FBS was
added along with one of the following: (a) buffer, (b) 100 ng/mLVEGF-C, (c)
10 Ag/mL hF4-3C5, (d)4Ag/mL neutralizing anti-CCL21, or (e)5Ag/mL
neutralizing anti-CCR7. The entire setup was placed in a 37jC, 5% CO
2
humidified incubator for 24 h and then imaged and quantified for cell
invasion into the other compartment. Imaging was done with the use of a
Zeiss LSM 510 Meta confocal microscope.
Immunoprecipitation and Western blot. Tumor cells were seeded
at 10
6
/mL into 300 AL of either type I collagen (2.5 mg/mL) or T25 flasks
(for two-dimensional comparisons) and maintained in basal media for 24 h.
Samples were then lysed with modified radioimmunoprecipitation assay
(RIPA) buffer and separated on a 7.5% [for VEGFR-2, VEGFR-3, and
neuropilin-2 (Nrp-2)] or 12.5% (for CCR7 and VEGF-C) polyacrylamide gel.
Protein was transferred onto a polyvinylidene difluoride membrane and
the following antihuman antibodies were used for detection: VEGFR-2
(0.1 Ag/mL,), VEGF-C (0.1 Ag/mL), CCR7 (0.2 Ag/mL), Nrp-2(1 Ag/mL; all
from R&D Systems), and VEGFR-3 (0.4 Ag/mL; sc-321, Santa Cruz). Blots
were then probed using an appropriate horseradish peroxidase–conjugated
secondary antibody (Bio-Rad) and developed using Western Pico ECL
substrate kit (Pierce). For immunoprecipitation, lysates were precleared
with protein A agarose beads (Sigma), then incubated in the presence of
agarose beads and the corresponding antibody overnight at 4jC. Samples
were then run on a gel as described above.
PCR. Tumor cells were seeded in 2.5 mg/mL type I collagen matrices (BD
Biosciences) at 10
6
/mL and maintained for 24 h. RNA was extracted using
Trizol (Invitrogen) following the manufacturer’s protocol. Reverse tran-
scription was done on 1 Ag of total RNA using iScript cDNA Synthesis Kit
(Bio-Rad). For real-time PCR, a mix of 10 ng cDNA and GoTaq DNA
Polymerase (Promega) was prepared for the amplification. Amplification
product was then loaded on a 2% agarose gel. The primers used for
detecting expression of VEGFR-3 were targeted against base pairs 736–846,
which is in the extracellular domain of the receptor (CGCTGGAGCT-
GCTGGTAGG and CCCGCTCTGCCTGCTTCC for the forward and reverse
sequences, respectively). CCL21 expression in human LECs was determined
using the forward and reverse primer sequences CAAGACTGGCAAGAAAG-
GAAAGGG and GGCTGCTCACTGGGCTATGG, respectively. All gene
expression data were normalized to the average expression of two
housekeeping genes, GAPDH (with forward sequence CACCCACTCCTC-
CACCTTTGAC and reverse sequence GTCCACCACCCTGTTGCTGTAG)
and EF1a1 (AGCAAAAATGACCCACCAATG and GGCCTGGATGGTTCAG-
GATA for forward and reverse sequences, respectively).
Cancer Research
Cancer Res 2009; 69: (1). January 1, 2009
350
www.aacrjournals.org