Sign up & Download
Sign in

VEGF-A, VEGF-C, and VEGF-D in colorectal cancer progression.

by Mark L George, Matthew G Tutton, Frank Janssen, Abed Arnaoutz, A Muti Abulafi, Suzanne A Eccles, R Ian Swift
Neoplasia New York Ny (2001)

Abstract

Abstract: We aimed to assess the relationship of the angiogenic cytokines VEGF-A, VEGF-C, and VEGF-D and their receptors VEGFR-2 and VEGFR-3 in the adenoma-carcinoma sequence and in metastatic spread of colorectal cancer (CRC). mRNA expression levels were measured using semi-quantitative reverse transcription polymerase chain reaction in 70 CRC (35 with paired mucosae) and 20 adenomatous polyps. Immuohistochemistry and ELISA assessed protein expression. VEGF-D mRNA expression was significantly lower in both polyps and CRCs compared with normal mucosa (P=.0002 and .002, respectively), whereas VEGF-A and VEGF-C were significantly raised in CRCs (P=.006 and .004, respectively), but not polyps (P=.22 and P=.5, respectively). Receptor expression was similar in tumor tissue and normal mucosae. Tumors with lymph node metastases had significantly higher levels of VEGF-A compared with non-metastatic tumors (P=.043). There was no association between VEGF-C or VEGF-D and lymphatic spread. The decrease in VEGF-D occurring in polyps and carcinomas may allow the higher levels of VEGF-A and VEGF-C to bind more readily to the VEGF receptors, and produce the angiogenic switch required for tumor growth. Increased expression of VEGF-A within CRCs was associated with lymphatic metastases, and therefore, this member of the VEGF family may be the most important in determining metastatic spread.

Cite this document (BETA)

Available from www.pubmedcentral.nih.gov
Page 1
hidden

VEGF-A, VEGF-C, and VEGF-D in colorectal cancer progression.

VEGF-A, VEGF-C, and VEGF-D in Colorectal Cancer Progression
Mark L. George* y, Matthew G. Tutton* y, Frank Janssen y, Abed Arnaout z, A. Muti Abulafi*, Suzanne A. Eccles y
and R. Ian Swift*
*Colorectal Unit, Mayday University Hospital, Thornton Heath, Croydon, Surrey CR7 7YE, UK; ySection of Cancer
Therapeutics, Institute of Cancer Research, Sutton, Surrey SM7 5NG, UK; zDepartment of Histopathology,
Mayday University Hospital, Thornton Heath, Croydon, Surrey CR7 7YE, UK
Abstract
We aimed to assess the relationship of the angiogenic
cytokines VEGF-A, VEGF-C, and VEGF-D and their
receptors VEGFR-2 and VEGFR-3 in the adenoma–
carcinoma sequence and in metastatic spread of color-
ectal cancer (CRC). mRNA expression levels were
measured using semi-quantitative reverse transcription
polymerase chain reaction in 70 CRC (35 with paired
mucosae) and 20 adenomatous polyps. Immuohisto-
chemistry and ELISA assessed protein expression.
VEGF-D mRNA expression was significantly lower in
both polyps and CRCs compared with normal mucosa
(P=.0002 and .002, respectively), whereas VEGF-A and
VEGF-C were significantly raised in CRCs (P=.006 and
.004, respectively), but not polyps (P=.22 and P=.5,
respectively). Receptor expression was similar in tumor
tissue and normal mucosae. Tumors with lymph node
metastases had significantly higher levels of VEGF-A
compared with non-metastatic tumors (P=.043). There
was no association between VEGF-C or VEGF-D and
lymphatic spread. The decrease in VEGF-D occurring in
polyps and carcinomas may allow the higher levels of
VEGF-A and VEGF-C to bind more readily to the VEGF
receptors, and produce the angiogenic switch required
for tumor growth. Increased expression of VEGF-A
within CRCs was associated with lymphatic metastases,
and therefore, this member of the VEGF family may be
the most important in determining metastatic spread.
Neoplasia (2001) 3, 420–427.
Keywords: angiogenesis, immunohistochemistry, staging, lymphatic, adenoma –
carcinoma.
Introduction
Neoangiogenesis, the formation of new capillaries from pre-
existing blood vessels, is essential for tumor development
beyond a diameter of 2 to 3 mm3 [1]. This process is
mediated by angiogenic cytokines and provides tumors not
only with nutrients for growth, but also increases the
opportunity for tumor cells to enter the circulation and
metastasize [2]. The most potent of these cytokines is
vascular endothelial growth factor (VEGF-A), a heparin-
binding glycoprotein with potent angiogenic, mitogenic, and
vascular permeability–enhancing activities specific for endo-
thelial cells.
The gene for human VEGF-A is organised into eight
exons and located on chromosome 6 [3]. As a result of
alternative splicing, at least four transcripts encoding mature
monomeric VEGF containing 121, 165, 189, and 206 amino
acid residues (VEGF121, VEGF165, VEGF189, and VEGF206)
have been detected. The secretion pattern of the four
isoforms differs markedly. VEGF121 is a weakly acidic
polypeptide that does not bind to heparin, and is freely
soluble. VEGF165, the predominant form secreted by a
variety of normal and transformed cells [4 ], is a basic
heparin-binding glycoprotein. Although secreted, a signifi-
cant portion remains bound to the cell surface or extracellular
matrix. The VEGF189 isoform includes 24 additional amino
acids and is not freely secreted, but instead remains
predominantly bound to the cell surface and/or extracellular
matrix [5 ]. VEGF206 is a rare isoform, so far identified only in
a human fetal liver cDNA library.
VEGF-C and VEGF-D, two more recently discovered
cytokines, have not only angiogenic properties but also a
lymphangiogenic action. VEGF-C is 48% identical to VEGF-
D with long NH2- and C-terminal extensions, which set
VEGF-C and VEGF-D apart as a subfamily of VEGF-related
proteins.
VEGF-A acts through the tyrosine kinase receptors Flt -1
( fms- like tyrosine kinase) /VEGFR-1 and KDR (kinase
insert domain-containing receptor ) /VEGFR-2, which are
expressed on vascular endothelium. VEGF-C and VEGF-D
act through VEGFR-2 and Flt -4 /VEGFR-3 [6,7 ], a receptor
that in adult normal tissues is restricted to the lymphatic
endothelium and high venular endothelium of lymph nodes.
The pattern of expression of VEGF-C in relation to VEGFR-3
during the sprouting of the embryonic lymphatic endothelium
confirms its importance in developing lymphatics [8,9], with
overexpression of VEGF-C resulting in lymphatic endothelial
proliferation and selective hyperplasia of the lymphatic
vasculature [10]. Thus, the association of VEGFR-3 and
its two ligands with lymphangiogenesis has provided a
Neoplasia . Vol. 3, No. 5, 2001, pp. 420 – 427
www.nature.com/neo
420
Abbreviations: CRC, colorectal cancer; RT - PCR, reverse transcription polymerase chain
reaction; VEGF, vascular endothelial growth factor; VEGFR, vascular endothelial growth
factor receptor
Address all correspondence to: Mark L. George, McElwain Building, Institute of Cancer
Research, 15 Cotswold Road, Belmont, Sutton SM2 5NG, UK. E-mail: mgeorge
@btinternet.com
Received 16 May 2001; Accepted 9 July 2001.
Copyright# 2001 Nature Publishing Group All rights reserved 1522-8002/01/$17.00
RESEARCH ARTICLE
Page 2
hidden
possible mechanism for primary tumors to metastasize via
newly formed lymphatics and has led to studies investigating
VEGF-C and lymphatic spread [11–13].
The expression of VEGF-D in tumors has not been
extensively studied, but in adenocarcinoma of the lung,
VEGF-D levels were found to be significantly lower than in
normal tissue [14], whereas others have been unable to
detect VEGF-D expression in either tumor biopsies or the
colorectal cell line SW 480 [15].
This study shows the changes in expression of VEGF-A,
VEGF-C, and VEGF-D and their receptors VEGFR-2 and
VEGFR-3 through the adenoma–carcinoma sequence, and
their association with metastatic spread in colorectal
carcinoma.
Materials and Methods
Tissue Samples
Twenty adenomatous polyps, removed either surgically
or at colonoscopy, and 70 sporadic colorectal cancers
(CRCs), of which 35 had a paired normal mucosa sample
taken 10 cm from the primary tumor, were studied. There
were 7 with Dukes A, 22 with Dukes B, 27 with Dukes C,
and 14 with Dukes D carcinoma. Seven of the Dukes C/D
tumors had a positive lymph node taken from the mesentery
for comparison with the primary tumor. Colonic mucosa
from five benign resections was also taken. All samples
were snap- frozen and stored in liquid nitrogen until RNA
extraction.
Reverse Transcription Polymerase Chain Reaction
(RT-PCR)
Total RNA was extracted from the tumor samples using
SV Total RNA Isolation System (Promega, Madison, WI,
USA). Two micrograms of total RNA was diluted in 16 l of
double distilled water (DDW) and denatured at 958C for 5
minutes; oligo (dT) primer was added (5 l of 5 RT buffer
and 2 g of oligo (dT)) and incubated for 15 minutes at 48C.
The primed RNA was reverse- transcribed and incubated for
60 minutes at 428C [5 l of M-MLV RT 5 buffer (Sigma,
St. Louis, MO, USA), 5 l of 1 mg/ml bovine serum albumin
(Sigma), 1 l of 5 U/l human placental ribonuclease
inhibitor (Promega rRNasin), 2 l of 350 mM  -mercaptoe-
thanol, 2 l of 25 mM dNTP (Sigma), 1 l of 200 mM sodium
pyrophosphate, 8 l of DDW, and 1 l of M-MLV reverse
transcriptase (Sigma)]. The cDNA was denatured for
5 minutes at 958C and stored at 208C until PCR.
PCR conditions were optimized such that the number of
cycles lays within the linear range of amplification. Five
microliters of cDNA was used for PCR reactions in a total
volume of 50 l of PCR mixture [1 l of 0.2 M sense and
antisense primer; 5.0 l of 10 PCR buffer (Sigma
REDTaq PCR reaction buffer 10 ), 5.0 l of 2.5 mM
dNTP (Sigma), 1.5 l of DNA polymerase (Sigma REDTaq
DNA polymerase) ]. Primers used are shown in Table 1.
PCR conditions were as follows: 28, 30, 32, 34, or 36
cycles of 1 minute at 948C, 2 minutes at 508C, and 1.0
minute at 728C for Beta-actin, VEGF-A, VEGFR-2,
VEGF-C, and VEGF-D, respectively. VEGFR-3 required
a hot start at 968C for 8 minutes, 568C for 3 minutes with
addition of 1.5 l of DNA polymerase, then 31 cycles of 1
minute at 948C, 2 minutes at 568C, and 1.0 minute at 728C.
Each PCR finished with an extension step of 10 minutes at
728C.
PCR was performed on 70 CRCs (35 with paired normal
mucosae), 20 adenomatous polyps, and 5 colonic mucosae
from benign resections in the case of VEGF-A, VEGF-C,
VEGF-D, and VEGFR-3. Due to insufficient cDNA, PCR for
VEGFR-2 was performed on 40 CRCs (14 with paired
normal mucosae), 13 adenomatous polyps, and 4 further
benign colonic mucosal samples.
PCR products were run on a 2% agarose gel with 0.1 g/
ml ethidium bromide. The gel was exposed to ultraviolet light
and the image captured using a Polaroid MP-4 Land
camera. Band intensity was analyzed by image analysis
(GelPro; Media Cybernetics, Silver Spring, MD, USA). The
intensity of the PCR products was semi-quantitated with the
intensity of their respective beta-actin band intensity, and is
expressed as arbitrary units.
Immunohistochemistry
VEGF-C and VEGF-D Four normal colonic resections, 11
adenomatous polyps, and 59 CRCs were examined. Paraffin
sections (5 m) were deparaffinized and placed in solution
of absolute methanol and 3% hydrogen peroxide for
30 minutes. After washing in distilled water and rinsing in
phosphate-buffered saline, slides were blocked with 1:10
diluted rabbit serum for 20 minutes. Slides were incubated
overnight at 48C in a humidified chamber with anti–VEGF-C
(Santa Cruz Biotechnology, Santa Cruz, CA, USA) or anti–
Table 1. Sequences of Primers Used for RT - PCR with Basepair Size.
Gene ( bp ) Sense Primer Antisense Primer Size
 -Actin 50 - TCGACAACGGCTCCGGCA -30 5 - AAGGTGTGGTGCCAGATT - 30 239
VEGF -A* 50 - CTCACCAAGGCCAGCACATAGG -30 50 -ATCTGGTTCCGAAAACCCTGAG - 30 159, 291, 363, 414
VEGF -C 50 - GTCTGTGTCCAGTGTAGATG - 30 50 -AGGTAGCTCGTGCTGGTGTT - 30 360
VEGF -D 50 - CAGTGAAGCGATCATCTCAGTC -30 50 -TACGAGGTGCTGGTGTTCATAC -30 397
KDR / VEGFR - 2 50 - GGAAATCATTATTCTAGTAGGCAC - 30 50 -CCTGTGGATACACTTTCGCGATG - 30 793
Flt - 4 / VEGFR -3 50 - AGCCATTCATCAACAAGCCT -30 50 -GGCAACAGCTGGATGTCATA - 30 298
*Four isoforms of VEGF - A 121, 165, 189, and 206, respectively.
Neoplasia . Vol. 3, No. 5, 2001
VEGF-A, -C, and -D George et al. 421

Sign up today - FREE

Mendeley saves you time finding and organizing research. Learn more

  • All your research in one place
  • Add and import papers easily
  • Access it anywhere, anytime

Start using Mendeley in seconds!

Already have an account? Sign in

Readership Statistics

4 Readers on Mendeley
by Discipline
 
 
by Academic Status
 
25% Doctoral Student
 
25% Other Professional
 
25% Researcher (at a non-Academic Institution)
by Country
 
25% United Kingdom
 
25% Austria
 
25% Spain