Cyclization Reaction Catalyzed by Bacillus cereus Branching Enzyme, and the Structure of Cyclic Glucan Produced by the Enzyme from Amylose

Abstract

Branching enzyme (BE) is widely distributed in animals , plants, yeasts, fungi, and bacteria and is responsible for formation of 1,6glucosidic (branching) linkages of amylopectin or glycogen in vivo. We have investigated the action of thermostable BE from Bacillus stearother-mophilus and demonstrated that the BE catalyzes cycliza-tion reaction of amylose and amylopectin in vitro in addition to the branching reaction (Fig. 1). 13) The product from amylopectin, the highlybranched cyclic dextrin, has been shown to have a number of characteristics useful for the food industry and marketed in Japan as a food ingredient with the trade name of Cluster Dextrin. Recently, we showed that the BE from a hyperthermophilic bacterium , Aquifex aeolicus, also catalyzes the cyclization reaction. 4) From the viewpoint of catalytic mechanisms, the cycli-zation reaction is not distinct from branching reaction: both reactions are cleavage of an 1,4glucosidic linkage of substrate followed by synthesis of an 1,6glucosidic linkage (Fig. 1). We therefore hypothesize that BEs from any sources catalyze both branching and cyclization reactions although the ratios of the reactions may be varied. However, only thermostable BEs have been demonstrated to catalyze cyclization until now. In this paper, we describe evidence for cyclization reaction of BE from a mesophile Bacillus cereus. The effect of molecular sizes of substrates on BE action profile is discussed based on the structural analyses of products from amyloses. MATERIALS AND METHODS Bacterial strains and plasmids. Bacillus cereus Q isolated by Okada et al. 5) from soil was used as a source of BE gene (glgB). A DNA fragment (600 bp) including a part of glgB was amplified by PCR using the chromo-somal DNA of B. cereus Q as a template. The primers 1 and 4 of which sequences have been shown in the reference 6 designed from conserved amino acid sequences of bacterial BEs were used for the PCR. To obtain the entire glgB chromosomal DNA was digested with restriction enzyme SalI , circularized with DNA ligase, and then used as a template for inverse PCR. To construct the recombi-nant plasmid for glgB expression, pETBE, a DNA fragment was again amplified by PCR using the chromosomal DNA as a template. The sequences of primers were 5 TTTCCATGGGTGTAATAAATTGTG3 and 5 TTTGGATCCTATTTACCACCAAAT3. The former Abstract: Branching enzyme (BE, 1,4-α-D-glucan: 1,4-α-D-glucan 6-α-D-(1,4-α-D-glucano)-transferase, EC 2.4.1.18) catalyzes transglycosylation to form α-1,6-glucosidic linkages of amylopectin or glycogen in vivo (branching reaction). It has already been demonstrated that the thermostable BEs from Bacillus stearothermo-philus and Aquifex aeolicus catalyze cyclization of amylose and amylopectin in vitro in addition to branching reaction. In this study, the action of a BE from mesophile Bacillus cereus on amylose was investigated in detail. The structural gene encoding BE was cloned from B. cereus Q, and expressed in Escherichia coli. BE was purified from a recombinant plasmid-harboring E. coli. The BE was most active at 30 C and pH 7.5. The activity was lost after incubation at 50 C for 30 min. BE action on amylose resulted in a degradation of the amylose without increasing reducing power. After the glucoamylase treatment of the BE products, cyclic molecules were isolated from the products, clearly indicating that the BE catalyzed cyclization reaction as the thermostable BEs. Furthermore, we tested the effect of molecular size of substrate on the action profile of BE. It was demonstrated that the BE converted any sizes of amyloses to a highly branched glucan with the same molecular size (weight-average molecular weight, 50,000).