Novel genetic polymorphisms in DNA repair genes: O(6)-methylguanine-DNA methyltransferase (MGMT) and N-methylpurine-DNA glycosylase (MPG) in lung cancer patients from Poland.

Abstract

Individuals with a decreased DNA repair capacity are at increased cancer risk. The aim of our investigation was to detect genetic polymorphisms in DNA repair genes. Two genes, MPG and MGMT, involved in repair of alkylated purines, have been selected. The genetic polymorphisms in the coding exons 2, 3 and 4 of MPG and in the enhancer region of MGMT were searched for in DNA samples from a group of 33 non-small-cell lung cancer (NSCLC) patients from Poland. The PCR products were sequenced with fluorescently labeled terminators and separated on automatic sequencer. Two polymorphisms in MPG were found: in exon 2: CGC-->TGC, (8603C>T, Genbank Accession Z69720) and in exon 3: CCG-->CCA, (12235G>A, Genbank Accession Z69720). The polymorphism in exon 2 results in amino acid substitution (Arg>Cys). Three polymorphisms within or around 59 bp enhancer of MGMT were detected: 1) 1034A>G (Genbank Accession X61657), 2) 1099C>T (Genbank Accession X61657), 3) 79G>T (Genbank Accession U95038). Polymorphism 2 is located in the 59-bp enhancer sequence, within a palindrome GGTGCGCACC. Polymorphism 3 destroys an inverted repeat GGGTGGGGGGCCGCCCTGACCCCCACCC that contains two PuF binding sequences GGGTGGG separated by Sp1 site. The nature and location of these polymorphisms is consistent with the hypothesis that they may have functional significance. Copyright 1999 Wiley-Liss, Inc.