Erratum: RPA complexes in Caenorhabditis elegans meiosis; Unique roles in replication, meiotic recombination and apoptosis' (Nucleic Acids Research (2021) 49 (2005-2026) DOI: 10.1093/nar/gkaa1293)

Abstract

The authors wish to introduce the following corrections to their article (1). 1) The DNA sequence for the OLLAS::RPA-1 is incorrect. The correct sequence is: TTCCCCAATTTTTATGTATCTGTTTCAGATAGTGAAAGATGTCCGGATTCGCCAACGAGCTCGGACCACG TCTCATGGGAAAGGCGGCAATTCACATCAATCACGATGTCTTCAATAA 2) In some places in the list of Strains rpa-1 was indicated to be placed on chromosome I, when its correct position is on chromosome II. The published article has been updated. These changes do not affect the results, discussion and conclusions presented in the article.