Detection and quantification of Aspergillus westerdijkiae in coffee beans based on selective amplification of beta-tubulin gene by using real-time PCR.

  • Morello L
  • Sartori D
  • de Oliveira Martinez A
 et al. 
  • 11

    Readers

    Mendeley users who have this article in their library.
  • N/A

    Citations

    Citations of this article.

Abstract

Aspergillus westerdijkiae is a new species of fungus that was recently dismembered from Aspergillus ochraceus taxon. Most isolates of A. westerdijkiae are able to produce large amounts of a mycotoxin called ochratoxin A (OA). OA has been found in food and beverages, such as coffee. A. westerdijkiae is very similar to A. ochraceus, and several isolates previously identified as A. ochraceus are now identified as A. westerdijkiae. By using sequences of the beta-tubulin gene, we analyzed several isolates from Brazilian coffee bean samples, previously identified as A. ochraceus, to compare with those of A. westerdijkiae. In fact, most (84%) were identified as A. westerdijkiae. Since this species consistently produces large amounts of OA, we developed a specific primer-pair for detecting and quantifying it in coffee beans by using real-time PCR. The primers Bt2Aw-F 5'TGATACCTTGGCGCTTGTGACG and Bt2Aw-R 5'CGGAAGCCTAAAAAATGAAGAG provided an amplicon of 347 bp in all A. westerdijkiae isolates, and no cross-reaction was observed using DNA from A. ochraceus. The sensitivity of real-time PCR was more than 100 times higher than the cfu technique.

Author-supplied keywords

  • Aspergillus
  • Aspergillus ochraceus
  • Aspergillus ochraceus: genetics
  • Aspergillus ochraceus: isolation & purification
  • Aspergillus ochraceus: metabolism
  • Aspergillus: genetics
  • Aspergillus: isolation & purification
  • Aspergillus: metabolism
  • Base Sequence
  • Coffea
  • Coffea: microbiology
  • Colony Count, Microbial
  • Cross Reactions
  • DNA, Fungal
  • DNA, Fungal: chemistry
  • DNA, Fungal: genetics
  • Food Contamination
  • Food Contamination: analysis
  • Gene Amplification
  • Genes, Fungal
  • Molecular Sequence Data
  • Ochratoxins
  • Ochratoxins: biosynthesis
  • Polymerase Chain Reaction
  • Polymerase Chain Reaction: methods
  • Seeds
  • Seeds: microbiology
  • Sensitivity and Specificity
  • Sequence Alignment
  • Species Specificity
  • Tubulin
  • Tubulin: genetics

Get free article suggestions today

Mendeley saves you time finding and organizing research

Sign up here
Already have an account ?Sign in

Authors

  • Luis Gustavo Morello

  • Daniele Sartori

  • André Luiz de Oliveira Martinez

  • Maria Lúcia Carneiro Vieira

  • Marta Hiromi Taniwaki

  • Maria Helena Pelegrinelli Fungaro

Cite this document

Choose a citation style from the tabs below

Save time finding and organizing research with Mendeley

Sign up for free