Low-copy microsatellite recovery from a conifer genome

  • Elsik C
  • Williams C
  • 36

    Readers

    Mendeley users who have this article in their library.
  • 34

    Citations

    Citations of this article.

Abstract

Nuclear DNA was isolated from fresh needle tissue of P. taeda parent 11–1060 after isolating nuclei and organelles using a modi-fication of Wagner et al. (1987). Pellets were incubated for 10 min in wash buffer (Britten et al. 1974) containing 0.5% Triton-X-100 to lyse chloroplasts and mitochondria. The resulting nuclear pel-lets were washed three times in wash buffer, prior to continuing with the modified CTAB procedure. Low-copy enrichment: preparation of clonable DNA Nuclear DNA was sonicated to fragments smaller than 1,200 bp and purified of metal ions (Werman et al. 1996). Fragments smaller than 400 bp were removed using glassmilk (Geneclean, Bio 101) resulting in an average size of 800 bp. Fragment ends were polished and then ligated to phosphorylated linkers (5 pTA - GTCCACGCGTAAGCAAGAGCACA - 3 3 ATCAGGTGCGCA - TTCGTTCTCG - 5 (Edwards et al . 1996) . This was the pool of clonable DNA used as the source in the low - copy enrich - ment and the DNA used to construct non - enriched genomic libraries . Low - copy enrichment : fish -hook preparation

Author-supplied keywords

  • Gymnosperms
  • Low-copy kinetic component
  • Pinus taeda
  • Reassociation kinetics
  • Triplet repeat sequences

Get free article suggestions today

Mendeley saves you time finding and organizing research

Sign up here
Already have an account ?Sign in

Find this document

Authors

  • C. G. Elsik

  • C. G. Williams

Cite this document

Choose a citation style from the tabs below

Save time finding and organizing research with Mendeley

Sign up for free