Protocols for Oligonucleotides and Analogs

Abstract

The 4-[N-methyl-N-(2,2,2-trifluoroacetyl)amino]butyl group for phosphate protection in the synthesis of oligodeoxyribonucleotides has been developed to completely prevent nucleobase alkylation by acrylonitrile that could potentially occur upon deprotection of the traditional 2-cyanoethyl phosphate protecting group. The properties of this new phosphate protecting group were evaluated using the model phosphotriester 9. The mechanism of phosphate deprotection was studied by treating 9 with concentrated NH 4 OH. NMR analysis of the deprotection reaction demonstrated that cleavage of the N-trifluoroacetyl group is rate-limiting. The resulting phosphotriester intermediate 13 was also shown to undergo rapid cyclodeesterification to produce O,O-diethyl phosphate 15 and N-methylpyrrolidine 16 (Scheme 2). Given the facile removal of the 4-[N-methyl-N-(2,2,2-trifluoroacetyl)amino]butyl phosphate protecting group under mild basic conditions, its utilization in oligonucleotide synthesis began with the preparation of the deoxyribonucleoside phosphoramidites 4a-d (Scheme 3). The coupling efficiency of 4a-d and conventional 2-cyanoethyl deoxyribonucleo-side phosphoramidites 24a-d was then compared in the solid-phase synthesis of the 20-mer d(ATCCGTAGCTAAGGTCATGC). As previously observed in the deprotection of 9, the 4-[N-methyl,N-(2,2,2-trifluoroacetyl)amino]butyl phosphate protecting groups were easily and completely removed from the oligonucleotide by using either concentrated NH 4 OH or pressurized ammonia gas. Analysis of the deprotected oligomer by polyacrylamide gel electrophoresis (Figure 3) indicated that the phosphoramidites 4a-d are as efficient as the 2-cyanoethyl phosphoramidites 24a-d in the synthesis of the 20-mer. Furthermore, following digestion of the crude 20-mer by snake venom phosphodiesterase and bacterial alkaline phosphatase, HPLC analysis showed complete hydrolysis to individual nucleosides and no detectable nucleobase modification. The facile and efficient production of synthetic oligo-nucleotides has spurred interest in the application of these biomolecules to a variety of diagnostics and therapeutic indications. 1 Oligonucleotides functionalized with reporter groups, intercalators, cross-linkers, affinity ligands, and DNA/RNA cleaving agents are examples of such applications. 2 Since its inception in the early 1980s, the phosphora-midite method for oligonucleotide synthesis 3 has been extensively applied to the production of synthetic oligo-mers on solid supports. 4 The method is most convenient when using the 2-cyanoethyl group for phosphate protection. 5 This group is eventually removed along with nucleobase protecting groups by treatment with either concentrated NH 4 OH or gaseous ammonia during oligo-nucleotide deprotection. 6 Under these conditions, 2-cya-noethyl groups undergo-elimination with the concomi-tant formation of acrylonitrile. 7 This side product is a potent carcinogen, 8 and alkylation of the nucleobase of nucleosides and oligonucleotides by acrylonitrile is well-documented in the literature. 8-13 While such production of acrylonitrile may appear inconsequential for small-scale oligonucleotide deprotec