In Table 2, the sequence of primer HpR3 is incorrect. The correct sequence of primer HpR3 is 5´ AAAACCAACAAAGGCCCGAA 3´. Please see the correct Table 2 here. (Table Presented).
CITATION STYLE
López-Sanmartín, M., Catanese, G., Grau, A., Valencia, J. M., García-March, J. R., & Navas, J. I. (2020). Erratum: Real-Time PCR based test for the early diagnosis of Haplosporidium pinnae affecting fan mussel Pinna nobilis (PLoS ONE (2019) 14: 2 (e0212028) DOI: 10.1371/journal.pone.0212028). PLoS ONE. Public Library of Science. https://doi.org/10.1371/journal.pone.0229548
Mendeley helps you to discover research relevant for your work.