After publication of this article [1], an error was reported in the 'Methods' section of the article under the subheading 'DNA extraction and library preparation'. The second primer associated with 926R was incorrectly stated as: "CAAGCAGAAGACGGCATACGA GATGCCGCATTCGATXXXXXXXXXXXXCCGTCAA TTCMTTTRAGT". The correct sequence for the experimental work was: "CAAGCAGAAGACGGCA TACGAGAT NNNNNNNNNNNN AGTCAGTCAG CC CCGTCAATTCMTTTRAGT".
CITATION STYLE
Seto, C. T., Jeraldo, P., Orenstein, R., Chia, N., & DiBaise, J. K. (2016). Erratum: Prolonged use of a proton pump inhibitor reduces microbial diversity: Implications for Clostridium difficile susceptibility [Microbiome, 4, (2016): 10]. DOI 10.1186/s40168-016-0158-1. Microbiome. BioMed Central Ltd. https://doi.org/10.1186/s40168-016-0158-1
Mendeley helps you to discover research relevant for your work.