Erratum: Prolonged use of a proton pump inhibitor reduces microbial diversity: Implications for Clostridium difficile susceptibility [Microbiome, 4, (2016): 10]. DOI 10.1186/s40168-016-0158-1

3Citations
Citations of this article
19Readers
Mendeley users who have this article in their library.

This article is free to access.

Abstract

After publication of this article [1], an error was reported in the 'Methods' section of the article under the subheading 'DNA extraction and library preparation'. The second primer associated with 926R was incorrectly stated as: "CAAGCAGAAGACGGCATACGA GATGCCGCATTCGATXXXXXXXXXXXXCCGTCAA TTCMTTTRAGT". The correct sequence for the experimental work was: "CAAGCAGAAGACGGCA TACGAGAT NNNNNNNNNNNN AGTCAGTCAG CC CCGTCAATTCMTTTRAGT".

Cite

CITATION STYLE

APA

Seto, C. T., Jeraldo, P., Orenstein, R., Chia, N., & DiBaise, J. K. (2016). Erratum: Prolonged use of a proton pump inhibitor reduces microbial diversity: Implications for Clostridium difficile susceptibility [Microbiome, 4, (2016): 10]. DOI 10.1186/s40168-016-0158-1. Microbiome. BioMed Central Ltd. https://doi.org/10.1186/s40168-016-0158-1

Register to see more suggestions

Mendeley helps you to discover research relevant for your work.

Already have an account?

Save time finding and organizing research with Mendeley

Sign up for free