Vitellogenins (Vgs) are yolk protein precursors that are regulated by juvenile hormone (JH) and/or 20-hydroxyecdysone (20E) in insects. JH acts as the principal gonadotropin that stimulates vitellogenesis in hemimetabolous insects. In this study, we cloned and characterized the Periplaneta americana Vitellogenin 2 (Vg2) promoter. Multiple sites for putative transcription factor binding were predicted for the 1,804 bp Vg2 promoter region, such as the Broad-Complex, ecdysone response element (EcRE), GATA, Hairy, JH response element (JHRE), and Methoprene (Met)-binding motif, among others. Luciferase reporter assay has identified that construct −177 bp is enough to support JH III induction but not 20E suppression. This 38 bp region (from −177 to −139 bp) contains two conserved response element half-sites separated by 2 nucleotides spacer (DR2) and is designated as Vg2RE (−168GAGTCACGGAGTCGCCGCTG−149). Mutation assay and luciferase assay data using mutated constructs verified the crucial role of G residues in Vg2RE for binding the isolated fat body nuclear protein. In Sf9 cells, a luciferase reporter placed under the control of a minimal promoter containing Vg2RE was induced by JH III in a dose- and time-dependent manner. Nuclear proteins isolated from previtellogenic female fat body cells bound to Vg2RE, and this binding was outcompeted by a 50-fold excess of cold Drosophila melanogaster DR4 and Galleria mellonella JH binding protein response elements (Chorion factor-I/Ultraspiracle). Affinity pull-down experiment with nuclear extracts of previtellogenic female fat body, using 31-bp probe Vg2RE as bait, yielded a 71 kDa candidate nuclear protein that may mediate the regulatory action of the JH III.
CITATION STYLE
Elgendy, A. M., Mohamed, A. A., Duvic, B., Tufail, M., & Takeda, M. (2021). Involvement of Cis-Acting Elements in Molecular Regulation of JH-Mediated Vitellogenin Gene 2 of Female Periplaneta americana. Frontiers in Physiology, 12. https://doi.org/10.3389/fphys.2021.723072
Mendeley helps you to discover research relevant for your work.