Skip to main content
Journal ArticleOPEN ACCESS

The nucleotide sequence of 5s rRNA from a cellular slime mold dictyostelium discoideum

Nucleic Acids Research (1980) 8(23) 5535-5539
DOI: 10.1093/nar/8.23.5535
35Citations
Citations of this article
5Readers
Mendeley users who have this article in their library.

This article is free to access.

Abstract

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoidum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). © 1980 IRL Press Limited.

Cite

CITATION STYLE

APA

Hori, H., Osawa, S., & Iwabuchi, M. (1980). The nucleotide sequence of 5s rRNA from a cellular slime mold dictyostelium discoideum. Nucleic Acids Research, 8(23), 5535–5539. https://doi.org/10.1093/nar/8.23.5535

Register to see more suggestions

Mendeley helps you to discover research relevant for your work.

Already have an account?

Save time finding and organizing research with Mendeley

Sign up for free