Whole genome sequencing of a novel temperate bacteriophage of P.aeruginosa: Evidence of tRNA gene mediating integration of the phage genome into the host bacterial chromosome

N/ACitations
Citations of this article
40Readers
Mendeley users who have this article in their library.

Abstract

Whole genome sequencing of a novel Pseudomonas aeruginosa temperate bacteriophage PaP3 has been completed. The genome contains 45 503bp with GC content of 52.1%, without more than 100bp sequence hitting homologue in all sequenced phage genomes. A total of 256 open reading frames (ORFs) are found in the genome, and 71 ORFs are predicated as coding sequence (CDS). All 71 CDS are divided into the two opposite direction groups, and both groups meet at the bidirectional terminator site locating the near middle of the genome. The genome is dsDNA with 5′-protruded cohesive ends and cohesive sequence is 'GCCGGCCCCTTTCCGCGTTA' (20 mer). There are four tRNA genes (tRNAAsn, tRNAAsp, tRNATyr and tRNAPro) clustering at the 5′-terminal of the genome. Analysis of integration site of PaP3 in the host bacterial genome confirmed that the core sequence of (GGTCGTAGGTTCGAATCCTAC-21mer) locates at tRNAPro gene within the attP region and at tRNALys gene in the attB region. The results indicated that 3′-end of tRNAPro gene of the PaP3 genome is involved in the integration reaction and 5′-end of tRNALys gene of host bacteria genome is hot spot of the integration. © 2006 The Authors; Journal compilation © 2006 Blackwell Publishing Ltd.

Cite

CITATION STYLE

APA

Tan, Y., Zhang, K., Rao, X., Jin, X., Huang, J., Zhu, J., … Hu, F. (2007). Whole genome sequencing of a novel temperate bacteriophage of P.aeruginosa: Evidence of tRNA gene mediating integration of the phage genome into the host bacterial chromosome. Cellular Microbiology, 9(2), 479–491. https://doi.org/10.1111/j.1462-5822.2006.00804.x

Register to see more suggestions

Mendeley helps you to discover research relevant for your work.

Already have an account?

Save time finding and organizing research with Mendeley

Sign up for free