BACKGROUND: Ataxia-telangiectasia (AT) is a rare autosomal recessive disorder that causes deficiency or dysfunction of the ataxia-telangiectasia mutated (ATM) protein. Not only AT patients, but also certain ATM heterozygous mutation carriers show a significantly reduced life expectancy due to cancer and ischemic heart disease; in particular, female carriers having particular alleles have an increased risk of breast cancer. The frequency of such risk heterozygotes at a population level remains to be fully determined, and evidence-based preventive medical guidelines have not yet been established. METHODS: Using the 3.5KJPNv2 allele frequency panel of Japanese Multi Omics Reference Panel v201902, which shows single-nucleotide variant (SNV) and insertion/deletion (INDEL) allele frequencies from 3552 Japanese healthy individuals, we investigated the diversity of ATM gene variants. RESULTS: We detected 2845 (2370 SNV and 475 INDEL) variants in the ATM gene, including 1338 (1160 SNV and 178 INDEL) novel variants. Also, we found a stop-gained SNV (NC_000008.11:g.108115650G > A (p.Trp266*)) and a disruptive-inframe-deletion (NC_000008.11:g. 108181014AAGAAAAGTATGGATGATCAAG/A (p.Ala1945_Phe1952delinsVal) and two frameshift INDELs (NC_000008.11:g.108119714CAA/C (p.Glu376fs) and NC_000008.11:g.108203577CTTATA/C (p.Ile2629fs)), which would be novel variants predicted to lead to loss of ATM functionality. CONCLUSION: The combination of population-based biobanking and human genomics provided a novel insight of diversity of ATM gene variants at a population level. For the advancement of precision medicine, such approach will be useful to predict novel pathogenic/likely pathogenic variants in the ATM gene and to establish preventive medical guidelines for certain ATM heterozygotes pertaining to their risk of particular diseases.
CITATION STYLE
Fukunaga, H., Taki, Y., & Prise, K. M. (2019, August 23). Diversity of ATM gene variants: a population-based genome data analysis for precision medicine. Human Genomics. NLM (Medline). https://doi.org/10.1186/s40246-019-0234-2
Mendeley helps you to discover research relevant for your work.