Abstract
Expression of Klebsiella aerogenes histidine utilization operons hutUH and hutIG is negatively regulated by the product of hutC. Multiple copies of the hutUH promoter region [hut(P)] present in trans were able to titrate the limited amount of host-encoded hut repressor (HutC). Thus, the hut(P) region contains a specific binding site for HutC. To identify DNA sequences required for HutC titration, we constructed and characterized a set of 40 left- entering and 28 right-entering deletions within a 250-bp DNA sequence containing the hut(P) region. Mutants carrying deletions that altered a unique dyad symmetric sequence, ATGCTTGTATAGACAAGTAT, from -11 to -30 relative to the hutUH promoter (hutUp) were unable to titrate hut repressor; mutants carrying deletions that left this sequence intact retained their ability to titrate hut repressor. Thus, we identify ATGCTTGT ACAAGTAT as the hutUH operator.
Cite
CITATION STYLE
Osuna, R., Schwacha, A., & Bender, R. A. (1994). Identification of the hutUH operator (hutUo) from Klebsiella aerogenes by DNA deletion analysis. Journal of Bacteriology. American Society for Microbiology. https://doi.org/10.1128/jb.176.17.5525-5529.1994
Register to see more suggestions
Mendeley helps you to discover research relevant for your work.