Expression of Klebsiella aerogenes histidine utilization operons hutUH and hutIG is negatively regulated by the product of hutC. Multiple copies of the hutUH promoter region [hut(P)] present in trans were able to titrate the limited amount of host-encoded hut repressor (HutC). Thus, the hut(P) region contains a specific binding site for HutC. To identify DNA sequences required for HutC titration, we constructed and characterized a set of 40 left- entering and 28 right-entering deletions within a 250-bp DNA sequence containing the hut(P) region. Mutants carrying deletions that altered a unique dyad symmetric sequence, ATGCTTGTATAGACAAGTAT, from -11 to -30 relative to the hutUH promoter (hutUp) were unable to titrate hut repressor; mutants carrying deletions that left this sequence intact retained their ability to titrate hut repressor. Thus, we identify ATGCTTGT ACAAGTAT as the hutUH operator.
CITATION STYLE
Osuna, R., Schwacha, A., & Bender, R. A. (1994). Identification of the hutUH operator (hutUo) from Klebsiella aerogenes by DNA deletion analysis. Journal of Bacteriology. American Society for Microbiology. https://doi.org/10.1128/jb.176.17.5525-5529.1994
Mendeley helps you to discover research relevant for your work.