Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines

41Citations
Citations of this article
42Readers
Mendeley users who have this article in their library.

This article is free to access.

Abstract

Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5′ CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3′) was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

Cite

CITATION STYLE

APA

Gao, Z., Liu, Y., Wang, X., Song, J., Chen, S., Ragupathy, S., … Newmaster, S. G. (2017). Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines. Scientific Reports, 7(1). https://doi.org/10.1038/s41598-017-05892-y

Register to see more suggestions

Mendeley helps you to discover research relevant for your work.

Already have an account?

Save time finding and organizing research with Mendeley

Sign up for free