Sensitive marker of the cisplatin-DNA interaction: X-ray photoelectron spectroscopy of CL

9Citations
Citations of this article
12Readers
Mendeley users who have this article in their library.

This article is free to access.

Abstract

The development of cisplatin and Pt-based analogues anticancer agents requires knowledge concerning the molecular mechanisms of interaction between such drugs with DNA. However, the binding dynamics and kinetics of cisplatin reactions with DNA determined by traditional approaches are far from satisfactory. In this study, a typical 20-base oligonucleotide (CGTGACAGTTATTGCAGGCG), as a simplified model representing DNA, was mixed with cisplatin in different molar ratios and incubation time. High-resolution XPS spectra of the core elements C, N, O, P, and Cl were recorded to explore the interaction between cisplatin and DNA. From deconvoluted Cl spectra we could readily differentiate the covalently bound chlorine from ionic chloride species in the cisplatin-oligo complexes, which displayed distinct features at various reaction times and ratios. Monitoring the magnitude and energy of the photoelectron Cl 2p signal by XPS could act as a sensitive marker to probe the interaction dynamics of chemical bonds in the reaction of cisplatin with DNA. At 37°C, the optimum incubation time to obtain a stable cisplatin-oligo complex lies around 20 hrs. This novel analysis technique could have valuable implications to understand the fundamental mechanism of cisplatin cytotoxicity and determine the efficiency of the bonds in treated cancer cells. © 2012 Fangxing Xiao et al.

Cite

CITATION STYLE

APA

Xiao, F., Yao, X., Bao, Q., Li, D., & Zheng, Y. (2012). Sensitive marker of the cisplatin-DNA interaction: X-ray photoelectron spectroscopy of CL. Bioinorganic Chemistry and Applications, 2012. https://doi.org/10.1155/2012/649640

Register to see more suggestions

Mendeley helps you to discover research relevant for your work.

Already have an account?

Save time finding and organizing research with Mendeley

Sign up for free