α-DNA VII. Solid phase synthesis of α-anomeric oligodeoxyribonucleotides

Abstract

An efficient procedure for the synthesis of unnatural α-anomeric oligodeoxyribonucleotides is described. This solid-phase procedure is based on the use of α-nucleoside phosphoramidites and α-nucleoside derivatized solid supports corresponding to the four natural bases and allow rapid synthesis of oligonucleotides up to 20 α-deoxynucleotide units in length. After HPLC purification, a 15-mer: α-d(CCTCTCGTTCTTTAC) and a 20-mer α-d(ATACTTGAGGAAGAGGTGTT) were obtained respectively in 27 and 29% overall yields. Their purity, nucleoside composition and primary structure were ascertained by HPLC and Maxam-Gilbert sequence analyses. © 1988 IRL Press Limited.