Determination of the aerolysin gene in Aeromonas hydrophila using the polymerase chain reaction (pcr) technique

Abstract

Aeromonas hydrophila is a bacterium that often causes outbreaks of fish diseases with high mortality rates. A. hydrophila has several virulence factors such as cytotoxin, protease, s-layers, and aerolysin. Aerolysin is an important virulence factor, as it is a marker of a strain of Aeromonas that can be virulent or not. This study aims to prove whether or not there is an aerolysin gene in the A.hydrophila isolates or not. The study was carried out using a PCR test on the A.hydrophila isolates from the Fish Disease and Environtmental Examination, Serang Banten (SRIsolate) and on the ATCC of A. hydrophila (ATCC Isolate) as a positive control. Biochemical tests and hemolysis in Blood Agar were carried out before the PCR test was carried out. The primer sequence used in the PCR process was "5'-'cctatggcctgagcgagaag'- '3» for the forward and "5'-'ccagttccagtcccaccact'-'3» for the reverse. The results show that the SR isolates have an aerolysin gene. These results show the formation of a band with a length of 430 bp that matches the amplicon target on the SR isolates.