Abstract
The original article contained two accession numbers in Table 2, JF957373.1 (tumor necrosis factor alpha, tnfα) and AY491056.1 (superoxide dismutase, sod), that correspond to Oreochromis aureus × O. niloticus and O. mossambicus, respectively. These accessions were adopted from previous Nile tilapia studies that used the same accession numbers and primer sets, including the following. Rashwan et al. (2024) Biology 13:486. https://doi.org/10.3390/biology13070486 Abdel-Latif et al. (2021) Biology 10:183. https://doi.org/10.3390/biology10030183 Qiang et al. (2016) Aquaculture International 24:1365-1378. https://doi.org/10.1007/s10499-016-9995-y Rashwan et al. (2024) Biology 13:486. https://doi.org/10.3390/biology13070486 Al-Deriny et al. (2020) Aquaculture Reports 17:100390. https://doi.org/10.1016/j.aqrep.2020.100390 Fadl et al. (2022) Ecotoxicology and Environmental Safety 242:113899. https://doi.org/10.1016/j.ecoenv.2022.113899 Although the cited accessions are not exclusively derived from O. niloticus, both tnfα and sod are conserved among Oreochromis species, showing strong sequence homology across coding regions. The primer binding sites used in this study align specifically with the corresponding O. niloticus transcripts. The primers yielded clear, single amplicons of the expected size in our qPCR assays, demonstrating their experimental specificity and efficiency. The primer sequences were revalidated by BLAST analysis against the O. niloticus genome and transcriptome, confirming their specificity to the intended targets. Therefore, the validity of the amplification, data interpretation and conclusions of the study remain unaffected. For clarity and taxonomic precision, the corrected Table 2 below lists the appropriate O. niloticus accession numbers corresponding to the amplified genes. (Table presented.) Primer sequences used for quantitative real-time PCR (qPCR) Gene Primer sequence (5′−3′) Accession number Annealing temperature (°C) Reference 1 F: GCACGCTCTGCTGGCCTTT R: GCGCTCAATCTTCCATCCC AB075952 59 Chang Geng Yang et al. (2013) 2 F: GATAATGGCAAACTTGTCGTCG R: ACATTGGAGCATCGGGTGAG JN381952 3 F: TCCTGTAGCCACACCCTCTC R: ACAGCTTTGGAAGCAGCACT NM_001279503.1 56 Costa et al. (2016) 4 F: TCCTAGACCTGGTGAAGCCA R: CGAGGTCGACAGTGCAGATT XM_003438121.3 Assar et al. (2025) 5 F: GCATCTGTCTCAGATCGTGCT R: TGCCATCATTACAATTGTCTCCG KT987208.1 60 Elkatatny et al. (2016) 6 F: CTGCCGTAAACGCAAGATGG R: ATCCGTTGACTGCTGAAGGG XM_003447296.4 57 Elbialy et al. (2024) 7 F: CTTCGCCATCATGAACGAGC R: CACCAACTCCATACCGCACT XM_003447926.3 8 F: CATGCCTTCGGAGACAACAC R: ACCTTCTCGTGGATCACCAT XM_003446807.5 57 Rashwan et al. (2024) 9 F: GGTGTGGATGCACCTGAGAA R: GGGAAATCGGTACTTGGCCT XM_013274267.2 57 Jia et al. (2019b) 10 F: AAGGGAAGCAGCAGCAGTTGTG R: GTCCATGCCGTTAGCCTTGAG XM_003460550.2 61 11 F: GGAAGCAGCTCCACTCTGATGA R: CACAGCGTGTCTCCTTCGTTCA NM_001279533.1 61 Rashwan et al. (2024) 12 F: GGCTCTTCGTCTGCTTCTGT R: GGGAAATCGAGGCGGTATCT GQ421464.1 60 Standen et al. (2016) 13 F: CTTCAGCGGAACAGGGTTA R: GAAGGCACTCCAGAAATAAGG XM_025901776.1 Y Zheng et al. (2016) 14 F: AATCGGGATAATCTCCTACA R: TTGGTCCTCTTTGCTATTTG XM_003438009.5 57 Hongqin Li et al. (2019) 15 F: GCAACATTGTGACGGCTCAGAT R: AGAGGGCGAGCATAGAGTCATACA XM_005465025.3 Yu-Xue Zhang et al. (2020) ef1a: elongation factor 1 alpha (housekeeping gene); gapdh: glyceraldehyde-3-phosphate dehydrogenase (housekeeping gene); igf1: insulin-like growth factor 1; igfbp1a: insulin-like growth factor binding protein 1a; mstn: myostatin; c3: complement 3; lzy: lysozyme; sod: superoxide dismutase; nrf2: nuclear factor erythroid 2–related factor 2; keap1: kelch-like ECH-associated protein 1; tnfα: tumer necrosis factor alpha; cas3: cysteine-aspartic acid protease 3; cas 9: cysteine-aspartic acid protease 9; ocln: occludin; cldn3: claudin3 The original article has been corrected.
Cite
CITATION STYLE
Elbialy, Z. I., Salah, A. S., Elahwl, I. A., Elsheshtawy, A., Assas, M., Abdelatty, A., & Assar, D. H. (2025, November 1). Correction to: Dietary Saccharomyces cerevisiae mitigates glyphosate-induced oxidative stress, immunotoxicity and apoptosis in Nile tilapia (Oreochromis niloticus) (Aquaculture International, (2025), 33, 6, (566), 10.1007/s10499-025-02247-7). Aquaculture International. Springer Science and Business Media Deutschland GmbH. https://doi.org/10.1007/s10499-025-02310-3
Register to see more suggestions
Mendeley helps you to discover research relevant for your work.