Antisense modulation of stearoyl-coa desaturase expression.

Abstract

Antisense compds., compns. and methods are provided for modulating the expression of stearoyl-CoA desaturase. The compns. comprise antisense compds., particularly antisense oligonucleotides, targeted to nucleic acids encoding stearoyl-CoA desaturase. Methods of using these compds. for modulation of stearoyl-CoA desaturase expression and for treatment of diseases assocd. with expression of stearoyl-CoA desaturase are provided. Thus, 20-residue, phosphorothioate-linked chimeric oligonucleotides comprising a 10-residue DNA core surrounded by 5-residue 2'-O-methoxyethylribosides "wings" were prepd. These "gapmers" exhibited up to significant inhibition of stearoyl-CoA desaturase (GenBank Accession No. AF097514) mRNA level in cell culture, such as HepG2 cells. Specifically, 67 antisense oligonucleotides, are claimed to exhibit at least 50% inhibitory activity of that of a pos. control oligonucleotide ISIS18078 (GTGCGCGCGAGCCCGAAATC, SEQ ID NO: 82), a 2'-O-methoxylgapmer (2'-O-methoxyethyls shown in bold) with a phosphorothioate backbone, which is targeted to human Jun-N-terminal kinase-2 (JNK2). [on SciFinder(R)]