Phylogenetic study of mangrove associate grass Myriostachya wightiana (Nees ex Steud.) Hook. F. using rbcL gene sequence

1Citations
Citations of this article
7Readers
Mendeley users who have this article in their library.

Abstract

Myriostachya is a monotypic genus in the family Poaceae, with the only known species Myriostachya wightiana (Nees ex Steud.) Hook.f. It is a mangrove associate grass primarily distributed along the muddy streams and channels in intertidal mangrove swamps of India, Bangladesh, Sri Lanka, Myanmar, Thailand and Sumatra. Molecular identification and evolutionary studies of M. wightiana is unreported till now. Therefore, in this study, the phylogenetic analysis of M. wightiana was established with related family members by using chloroplast rbcL gene-based systematics. The molecular phylogeny was accomplished by DNA extraction, PCR amplification and sequencing of the rbcL gene and phylogenetic analysis. The genomic DNA was extract using the CTAB method and the rbcL gene amplification is by using the F-5IATGTCACCACAAACAGAAACTAAAGC3I and R-5ICTTCGGCACAAAATAAGAAACGATCTC3I primers. Phylogenetic analysis of M. wightiana was performed by multiple sequence alignment with UPGMA, and the Maximum-parsimony phylogenetic tree was constructed using MEGAX. Myriostachya wightiana rbcL gene sequence shows the highest similarity to Paspalum species, and in the phylogenetic tree M. wightiana has a close branch with Paspalum vaginatum. The evolutionary divergence from M. wightiana is maximum (0.49) to Sorghum propinquum and minimum (0.01) to Oryza officinalis and Oryza punctata. This study concluded that M. wightiana has a strong morphological and phylogenetic relationship with salt-tolerant Paspalum sp.

Cite

CITATION STYLE

APA

Kiran Kumar, M., & Sandeep, B. V. (2021). Phylogenetic study of mangrove associate grass Myriostachya wightiana (Nees ex Steud.) Hook. F. using rbcL gene sequence. Plant Science Today, 8(3), 590–595. https://doi.org/10.14719/PST.2021.8.3.1133

Register to see more suggestions

Mendeley helps you to discover research relevant for your work.

Already have an account?

Save time finding and organizing research with Mendeley

Sign up for free