Correction to: Evaluation of microbial communities in peels of Brazilian tropical fruits by amplicon sequence analysis (Brazilian Journal of Microbiology, (2019), 50, 3, (739-748), 10.1007/s42770-019-00088-0)

Abstract

The original version of this article unfortunately contained two mistakes in the “Materials and methods” section, subsection “DNA extraction and PCR” of the article. The correct information is given below. 1. Bacterial primer: The last paragraph of the 4th page: Text with the wrong primer sequence: “...and 783r-CS2 (5'- ACC MGGGTATCTAATCCKG-3')...” The red-lettered GGTCT has to be removed. To be corrected as (the correct sequence is): “...and 783r-CS2 (5'-ACC MGGGTATCTAATCCKG-3')...” 2. Fungal primer: The first paragraph on page 5: “...and CS2 (TACGGTAGCAGAGACTT) adaptors...” GGTCT has to be added to the right end of the CS2 primer, that is, “...and CS2 (TACGGTAGCAGAGACTTGGTCT)...”.