Compound Heterozygous PIGS Variants Associated With Infantile Spasm, Global Developmental Delay, Hearing Loss, Visual Impairment, and Hypotonia

8Citations
Citations of this article
9Readers
Mendeley users who have this article in their library.

Abstract

Glycosylphosphatidylinositol (GPI) is a membrane anchor for cell surface proteins. Inherited GPI deficiencies are a new subclass of congenital disorders of glycosylation. Phosphatidylinositol glycan class S (PIGS) is a subunit of the GPI transamidase which plays important roles in many biological processes. In this study, we present a Chinese boy with infantile spasms (ISs), severe global developmental delay, hearing loss, visual impairment (cortical blindness), hypotonia, and intellectual disability and whose whole-exome sequencing (WES) identified compound heterozygous variants in PIGS (MIM:610271):c.148C > T (p.Gln50∗) and c.1141_1164dupGACATGGTGCGAGTGATGGAGGTG (p.Asp381_Val388dup). Flow cytometry analyses demonstrated that the boy with PIGS variants had a decreased expression of GPI-APs. This study stresses the importance of including the screening of PIGS gene in the case of pediatric neurological syndromes and reviews the clinical features of PIGS-associated disorders.

Cite

CITATION STYLE

APA

Zhang, L., Mao, X., Long, H., Xiao, B., Luo, Z., Xiao, W., & Jin, X. (2020). Compound Heterozygous PIGS Variants Associated With Infantile Spasm, Global Developmental Delay, Hearing Loss, Visual Impairment, and Hypotonia. Frontiers in Genetics, 11. https://doi.org/10.3389/fgene.2020.00564

Register to see more suggestions

Mendeley helps you to discover research relevant for your work.

Already have an account?

Save time finding and organizing research with Mendeley

Sign up for free